pCMV3-C-GFPSpark®

pCMV3-C-GFPSpark® Physical Map
Download sequence
pCMV3-C-GFPSpark® Physical Map

Comments for pCMV3-C-GFPSpark®:

  • • CMV promoter: bases 250-837
  • • Enhancer: bases 838-1445
  • • SV40 early promoter: bases 3089-3458
  • • Hygromycin ORF: bases 3476-4501
  • • pUC origin: bases 5144-5817
  • • Kanamycin ORF: bases 5891-6706

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Expression Vector pCMV3-C-GFPSpark® Information Description

Vector Name pCMV3-C-GFPSpark®
Vector Size 6848bp
Vector Type Mammalian Expression Vector
Expression Method Constitutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag GFPSpark®
Sequencing Primer Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG)

GFPSpark® Tag Information

GFPSpark® is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark® is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Mammalian Expression Vectors

More Reagents and Services