IL-1F6 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

IL-1F6 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
483 bp
Description
Full length Clone DNA of Mouse interleukin 1 family, member 6 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-1F6 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

FIL1 cDNA ORF Clone, Mouse; FIL1(EPSILON) cDNA ORF Clone, Mouse; FIL1E cDNA ORF Clone, Mouse; IL-1F6 cDNA ORF Clone, Mouse; IL1(EPSILON) cDNA ORF Clone, Mouse; IL1F6 cDNA ORF Clone, Mouse

IL-1F6 Background Information

Interleukin-1 family member 6 (IL-1F6), also known as interleukin 36, alpha (IL36A), is a pro-inflammatory cytokine which plays an important role in innate and adaptive immunity. IL-1F6 activates MAPK and NF-kB pathways and is produced by many different cells. This cytokine is a family member of interleukin-1 (IL-1) and plays an important role in the pathophysiology of several diseases. It has been reported that IL-1F6 and IL-1F8, in addition to IL-1F9, activate the pathway leading to NF-kappaB in an IL-1Rrp2-dependent manner in Jurkat cells as well as in multiple other human and mouse cell lines. Activation of the pathway leading to NF-kappaB by IL-1F6 and IL-1F8 follows a similar time course to activation by IL-1beta, suggesting that signaling by the novel family members occurs through a direct mechanism. In a mammary epithelial cell line, NCI/ADR-RES, which naturally expresses IL-1Rrp2, all three cytokines signal without further receptor transfection. IL-1Rrp2 antibodies block activation of the pathway leading to NF-kappaB by IL-1F6, IL-1F8, and IL-1F9 in both Jurkat and NCI/ADR-RES cells. Thus IL-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP.
Full Name
interleukin 36, alpha
References
  • Tripodi D, et al. (2012) IL-36 a new member of the IL-1 family cytokines. J Biol Regul Homeost Agents. 26(1):7-14.
  • Towne JE, et al. (2004) Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP to activate the pathway leading to NF-kappaB and MAPKs. J Biol Chem. 279(14): 13677-88.
  • Kumar S, et al. (2000) Identification and initial characterization of four novel members of the interleukin-1 family. J Biol Chem. 275(14): 10308-14.
Add to Cart Successfully Add to Cart Failed