CD132 cDNA ORF Clone, Mouse, C-His tag

1/1
Price:
Size:
Number:

CD132 cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1155 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interleukin 2 receptor, gamma chain with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + NotI(6kb+1.16kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD132 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD132 cDNA ORF Clone, Mouse, C-His tag: Validated Images

CD132 cDNA ORF Clone, Mouse, C-His tag: Alternative Names

CD132 cDNA ORF Clone, Mouse; gamma(c) cDNA ORF Clone, Mouse; gc cDNA ORF Clone, Mouse; [g]c cDNA ORF Clone, Mouse

CD132 Background Information

The common gamma chain (γc) (or CD132), also known as interleukin-2 receptor subunit gamma or IL2RG, is a member of the type I cytokine receptor family expressed on most lymphocyte (white blood cell) populations, and its gene is found on the X-chromosome of mammals. The common gamma chain (γc) (or IL2RG), is a cytokine receptor sub-unit that is common to the receptor complexes for at least six different interleukin receptors: IL-2, IL-4, IL-7, IL-9, IL-15 and interleukin-21 receptor. It is a component of multiple cytokine receptors that are essential for lymphocyte development and function. X-linked severe combined immunodeficiency (XSCID) is a rare and potentially fatal disease caused by mutations of IL2RG, the gene encoding IL2RG. IL2RG was demonstrated to be a component of the IL-4 receptor on the basis of chemical cross-linking data, the ability of IL2RG to augment IL-4 binding affinity. The observation that IL-2R gamma is a functional component of the IL-4 receptor, together with the finding that IL-2R gamma associates with the IL-7 receptor, begins to elucidate why deficiency of this common gamma chain (gamma c) has a profound effect on lymphoid function and development, as seen in X-linked severe combined immunodeficiency.
Full Name
interleukin 2 receptor, gamma
References
  • Russell SM, et al. (1993) Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science. 262 (5141): 1880-3.
  • Miyazaki T, et al. (1994) Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits. Science. 266 (5187): 1045-7.
  • Takeshita T, et al. (1992) Cloning of the gamma chain of the human IL-2 receptor. Science. 257 (5068): 379-82.
Add to Cart Successfully Add to Cart Failed