IL-23 P19 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

IL-23 P19 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
591 bp
Description
Full length Clone DNA of Mouse interleukin 23, alpha subunit p19 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL-23 P19 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

IL-23 cDNA ORF Clone, Mouse; p19 cDNA ORF Clone, Mouse

IL-23 P19 Background Information

IL-23, which is mainly secreted by antigen-presenting cells, is a member of the IL-12 family, which includes IL-12, IL-27, and IL-35[1]. IL-23 is a heterodimeric cytokine, comprised a unique p19 subunit and p4 subunit, the latter of which is shared with IL-12. The receptor for IL-23 consists of IL-23R and IL-12Rβ1, the latter of which is also characteristic of IL-12. IL-23 is essential for Th17 differentiation, expansion, and survival by binding to its receptor, thereby activating the signaling pathway [11,12]. Many studies revealed that the IL-23/Th17 pathway is implicated in the pathophysiology of various autoimmune diseases, such as autoimmune arthritis[13], primary biliary cirrhosis[14], and inflammatory bowel disease[15].Immune CheckpointImmunotherapyCancer ImmunotherapyTargeted Therapy
Full Name
interleukin 23, alpha subunit p19
References
  • Ye X, Zhang L, Wang H, et al. The Role of IL-23/Th17 Pathway in Patients with Primary Immune Thrombocytopenia. Kuwana M, ed. PLoS ONE. 2015;10(1):e0117704.

IL-23 P19 cDNA ORF Clone, Canine, Related Products

IL-23 P19 cDNA ORF Clone, Rhesus, Related Products

Add to Cart Successfully Add to Cart Failed