
Cynomolgus monkey CXCR4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXCR4cDNA Clone Product Information
Gene Bank Ref.ID:unsubmitted
cDNA Size:1059
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chemokine (C-X-C motif) receptor 4 DNA.
Gene Synonym:CXCR4
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Chemokine & Receptor Related Products
Product nameProduct name
Human CXCL2 / MIP-2 ProteinRat CXCL1 / MGSA / NAP-3 ProteinRat CXCL2 / MIP-2 ProteinHuman CCL2 / MCP-1 / MCP1 Protein (His Tag)Human CCL23 / MIP 3 Protein (His Tag)Mouse NAP-2 / PPBP / CXCL7 Protein (aa 49-109, His Tag)Mouse NAP-2 / PPBP / CXCL7 Protein (aa 40-113, His Tag)Mouse CCL22 / MDC Protein (His Tag)Mouse CXCL14 / BRAK ProteinMouse CXCL1 / MGSA / NAP-3 ProteinHuman NAP-2 / PPBP / CXCL7 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human CCL13 / MCP-4 Protein (His Tag)Human CCL18 / PARC / MIP4 Protein (His Tag)Mouse CCL2 / MCP-1 / MCP1 Protein (His Tag)Human CCL16 / HCC-4 / NCC4 Protein (His Tag)Human CCL16 / HCC-4 / NCC4 Protein (His Tag)Human CCL4 / MIP1B Protein (His Tag)Human CCL3 / Mip1a Protein (His Tag)Human I-309 / CCL1 / TCA-3 Protein (Fc Tag)Human Fractalkine / CX3CL1 Protein (His Tag)Human CXCL12 / SDF1b Protein (Fc Tag)Human CXCL4 / PF4 ProteinHuman IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human CXCL3 / GRO gamma Protein (His Tag)Human CCL5 / RANTES Protein (His & mucin Tag)Mouse CXCL16 / SR-PSOX Protein (His Tag)Human MCP-3 / CCL7 Protein (His Tag)Human CCL8 / MCP-2 Protein (SUMO Tag)Human CXCL1 / MGSA / NAP-3 Protein (His & SUMO Tag)Human CCL17 / TARC / SCYA17 Protein (His Tag)Mouse CXCL2 / GRO2 / MIP-2 (His & SUMO Tag)Human CCL15 / MIP-5 / MIP-1 delta Protein (aa 22-113, His Tag)Human CCL17 / TARC / SCYA17 ProteinMouse CCL8 / MCP-2 Protein (His & NusA Tag)Mouse CCL6 / C-C motif ligand 6 Protein (His Tag)Cynomolgus CXCL13 / BCA-1 / BLC Protein (His Tag)Human CXCL1 / MGSA / NAP-3 Protein (His & NusA Tag)Cynomolgus CXCL12 / SDF-1 Protein (Fc Tag)Mouse CXCL9 / MIG / C-X-C motif chemokine 9 ProteinHuman CXCL9 / MIG / C-X-C motif chemokine 9 ProteinHuman CCL21 / 6Ckine ProteinHuman CCL14 / HCC-1 / HCC-3 Protein (His Tag)Mouse CCL17 / TARC ProteinCynomolgus / Rhesus Fractalkine / CX3CL1 Protein (Fc Tag)Human CCL14 / HCC-1 / HCC-3 Protein (aa 28-93, His Tag)Human MCP-3 / CCL7 Protein (His Tag)Mouse I-309 / CCL1 / TCA-3 Protein (Fc Tag)Human CCL11 Protein (His Tag)Human CXCL12 / SDF-1 ProteinMouse XCL1 Protein (His Tag)Rat NAP-2 / PPBP / CXCL7 Protein (Fc Tag)Human XCL1 Protein (His Tag)Human CCL15 / MIP-5 / MIP-1 delta Protein (aa 46-113, His Tag)Human XCL2 Protein (His Tag)Human CXCL12 / SDF-1 Protein (isoform a, His Tag)Rat CXCL16 / SR-PSOX Protein (His Tag)Cynomolgus XCL1 Protein (His Tag)Human CCL22 / MDC Protein (His Tag)Mouse CCL20 / MIP-3 alpha Protein (His Tag)Human CCL24 / Eotaxin-2 / MPIF-2 Protein (His Tag)Human CXCL12 / SDF-1 Protein (isoform a)Cynomolgus CCL21 / 6Ckine ProteinHuman CXCL1 / MGSA / NAP-3 ProteinHuman FAM19A2 Protein (Fc Tag)Human CXCL10 / Crg-2 ProteinCanine IL-8 / CXCL8 ProteinRat CXCL16 / SR-PSOX Protein (Fc Tag)Cynomolgus NAP-2 / PPBP / CXCL7 Protein (Fc Tag)Human CXCL5 ProteinHuman I-309 / CCL1 / TCA-3 ProteinMouse CCL3 / Mip1a ProteinCynomolgus CCL17 / TARC Protein (His Tag)Mouse CXCL12 / SDF-1 ProteinCynomolgus CXCL9 / MIG / C-X-C motif chemokine 9 ProteinCynomolgus IL-8 / CXCL8 ProteinCanine CXCL12 / SDF-1 ProteinCanine CXCL13 / BCA-1 Protein (His Tag)Human CCL28 Protein (His Tag)Canine CXCL16 / SR-PSOX Protein (His Tag)Human CCL27 / CTACK Protein (His Tag)Human CXCL14 / BRAK ProteinHuman CCL23 / MIP 3 Protein (His Tag)Human CCL23 / MIP 3 ProteinCanine CXCL16 / SR-PSOX Protein (Fc Tag)Canine Fractalkine / CX3CL1 Protein (Fc Tag)Canine Fractalkine / CX3CL1 ProteinCanine XCL1 Protein (His Tag)Human CCL20 / MIP-3 alpha Protein (His Tag)Rat CCL3 / Mip1a ProteinHuman FAM19A4 / TAFA4 Protein (Fc Tag)Mouse MCP-3 / CCL7 Protein (His Tag)Human CCL5 / RANTES Protein
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks