
Text Size:AAA

Influenza B (B/Victoria/504/2000) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
Gene Bank Ref.ID:
cDNA Size:1755
cDNA Description:ORF Clone of Influenza B (B/Victoria/504/2000) Hemagglutinin DNA.
Gene Synonym:Hemagglutinin, HA
Species:Influenza B
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks