クイック注文

Mouse CD3E Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD3EcDNA Clone Product Information
Gene Bank Ref.ID:NM_007648.4
cDNA Size:570
cDNA Description:ORF Clone of Mus musculus CD3 antigen, epsilon polypeptide DNA.
Gene Synonym:CD3, T3e, AI504783, CD3epsilon, Cd3e
Species:Mouse
Vector:pCMV3-N-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-HA Vector Information
 
Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-HA Physical Map
Schematic of pCMV3-N-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

T-cell surface glycoprotein CD3 epsilon chain, also known as CD3E, is a single-pass type I membrane protein. CD3E contains 1 Ig-like (immunoglobulin-like) domain and 1 ITAM domain. CD3E, together with CD3-gamma, CD3-delta and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The CD3 epsilon subunit of the T cell receptor (TCR) complex contains two defined signaling domains, a proline-rich sequence and an immune tyrosine activation motifs (ITAMs), and this complex undergoes a conformational change upon ligand binding that is thought to be important for the activation of T cells. In the CD3 epsilon mutant mice, all stages of T cell development and activation that are TCR-dependent were impaired, but not eliminated, including activation of mature naïve T cells with the MHCII presented superantigen, staphylococcal enterotoxin B, or with a strong TCR cross-linking antibody specific for either TCR-Cbeta or CD3 epsilon. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. CD3E plays an essential role in T-cell development, and defects in CD3E gene cause severe immunodeficiency. Homozygous mutations in CD3D and CD3E genes lead to a complete block in T-cell development and thus to an early-onset severe combined immunodeficiency phenotype.

References
  • Fischer A, et al. (2005) CD3 deficiencies. Curr Opin Allergy Clin Immunol. 5(6): 491-5.
  • Wang Y, et al. (2009) A conserved CXXC motif in CD3epsilon is critical for T cell development and TCR signaling. PLoS Biol. 7(12): e1000253.
  • Martnez-Martn N, et al. (2009) Cooperativity between T cell receptor complexes revealed by conformational mutants of CD3epsilon. Sci Signal. 2(83): ra43.
  • Deford-Watts LM, et al. (2009) The cytoplasmic tail of the T cell receptor CD3 epsilon subunit contains a phospholipid-binding motif that regulates T cell functions. J Immunol. 183(2): 1055-64.
  • Catalog:MG50410-NY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"