VCAM1 cDNA ORF Clone, Rat, untagged

Cat: RG80233-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VCAM1 Reagents
CRO Services
Product recommended

All VCAM1 Reagents
VCAM1 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2220 bp
Description
Full length Clone DNA of Rat vascular cell adhesion molecule 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VCAM1 Background Information

Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
vascular cell adhesion molecule 1
References
  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.
  • VCAM1 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    VCAM1 cDNA ORF Clone in Cloning Vector, Ferret FG60134-G
    VCAM1 cDNA ORF Clone, Ferret, untagged FG60134-UT
    VCAM1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60134-ACGLN
    VCAM1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60134-ACG
    VCAM1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60134-ACR
    VCAM1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60134-CF
    VCAM1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60134-NF
    VCAM1 cDNA ORF Clone, Ferret, C-His tag FG60134-CH
    VCAM1 cDNA ORF Clone, Ferret, N-His tag FG60134-NH
    VCAM1 cDNA ORF Clone, Ferret, C-HA tag FG60134-CY
    VCAM1 cDNA ORF Clone, Ferret, N-HA tag FG60134-NY
    VCAM1 cDNA ORF Clone, Ferret, C-Myc tag FG60134-CM
    VCAM1 cDNA ORF Clone, Ferret, N-Myc tag FG60134-NM

    VCAM1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    VCAM1 cDNA ORF Clone in Cloning Vector, Rat RG80233-G
    VCAM1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80233-ACGLN
    VCAM1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80233-ACG
    VCAM1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80233-ACR
    VCAM1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80233-CF
    VCAM1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80233-NF
    VCAM1 cDNA ORF Clone, Rat, C-His tag RG80233-CH
    VCAM1 cDNA ORF Clone, Rat, N-His tag RG80233-NH
    VCAM1 cDNA ORF Clone, Rat, C-HA tag RG80233-CY
    VCAM1 cDNA ORF Clone, Rat, N-HA tag RG80233-NY
    VCAM1 cDNA ORF Clone, Rat, C-Myc tag RG80233-CM
    VCAM1 cDNA ORF Clone, Rat, N-Myc tag RG80233-NM
    VCAM1 qPCR Primer Pairs, Rat RP300220

    VCAM1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    VCAM1 cDNA ORF Clone in Cloning Vector, Mouse MG50163-M
    VCAM1 cDNA ORF Clone, Mouse, untagged MG50163-UT
    VCAM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50163-ACGLN
    VCAM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50163-ACG
    VCAM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50163-ACR
    VCAM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50163-CF
    VCAM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50163-NF
    VCAM1 cDNA ORF Clone, Mouse, C-His tag MG50163-CH
    VCAM1 cDNA ORF Clone, Mouse, N-His tag MG50163-NH
    VCAM1 cDNA ORF Clone, Mouse, C-HA tag MG50163-CY
    VCAM1 cDNA ORF Clone, Mouse, N-HA tag MG50163-NY
    VCAM1 cDNA ORF Clone, Mouse, C-Myc tag MG50163-CM
    VCAM1 cDNA ORF Clone, Mouse, N-Myc tag MG50163-NM
    VCAM1 qPCR Primer Pairs, Mouse MP200193

    VCAM1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    VCAM1 cDNA ORF Clone in Cloning Vector, Human HG10113-M
    VCAM1 cDNA ORF Clone, Human, untagged HG10113-UT
    VCAM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10113-ACG
    VCAM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10113-ACGLN
    VCAM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10113-ACR
    VCAM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10113-CF
    VCAM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10113-NF
    VCAM1 cDNA ORF Clone, Human, C-His tag HG10113-CH
    VCAM1 cDNA ORF Clone, Human, N-His tag HG10113-NH
    VCAM1 cDNA ORF Clone, Human, C-HA tag HG10113-CY
    VCAM1 cDNA ORF Clone, Human, N-HA tag HG10113-NY
    VCAM1 cDNA ORF Clone, Human, C-Myc tag HG10113-CM
    VCAM1 cDNA ORF Clone, Human, N-Myc tag HG10113-NM
    VCAM1 qPCR Primer Pairs, Human HP100188
    info info
    添加购物车成功! 添加购物车失败!