UMPS cDNA ORF Clone, Rat, C-His tag

Cat: RG81051-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All UMPS Reagents
CRO Services
Product recommended

All UMPS Reagents
UMPS cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1446 bp
Description
Full length Clone DNA of Rat uridine monophosphate synthetase with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UMPS Background Information
Full Name
uridine monophosphate synthetase

UMPS cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UMPS cDNA ORF Clone in Cloning Vector, Rat RG81051-U
UMPS cDNA ORF Clone, Rat, untagged RG81051-UT
UMPS cDNA ORF Clone, Rat, C-GFPSpark® tag RG81051-ACG
UMPS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81051-ACGLN
UMPS cDNA ORF Clone, Rat, N-GFPSpark® tag RG81051-ANG
UMPS cDNA ORF Clone, Rat, C-OFPSpark® tag RG81051-ACR
UMPS cDNA ORF Clone, Rat, N-OFPSpark® tag RG81051-ANR
UMPS cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81051-CF
UMPS cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81051-NF
UMPS cDNA ORF Clone, Rat, N-His tag RG81051-NH
UMPS cDNA ORF Clone, Rat, C-HA tag RG81051-CY
UMPS cDNA ORF Clone, Rat, N-HA tag RG81051-NY
UMPS cDNA ORF Clone, Rat, C-Myc tag RG81051-CM
UMPS cDNA ORF Clone, Rat, N-Myc tag RG81051-NM
UMPS qPCR Primer Pairs, Rat RP301015

UMPS cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UMPS cDNA ORF Clone in Cloning Vector, Mouse MG5A2807-U
UMPS cDNA ORF Clone, Mouse, untagged MG5A2807-UT
UMPS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2807-ACGLN
UMPS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2807-ACG
UMPS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2807-ANG
UMPS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2807-ACR
UMPS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2807-ANR
UMPS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2807-CF
UMPS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2807-NF
UMPS cDNA ORF Clone, Mouse, C-His tag MG5A2807-CH
UMPS cDNA ORF Clone, Mouse, N-His tag MG5A2807-NH
UMPS cDNA ORF Clone, Mouse, C-HA tag MG5A2807-CY
UMPS cDNA ORF Clone, Mouse, N-HA tag MG5A2807-NY
UMPS cDNA ORF Clone, Mouse, C-Myc tag MG5A2807-CM
UMPS cDNA ORF Clone, Mouse, N-Myc tag MG5A2807-NM

UMPS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UMPS cDNA ORF Clone, Human, untagged HG18334-UT
info info
添加购物车成功! 添加购物车失败!