UBE2G2 cDNA ORF Clone, Rat, N-His tag

Cat: RG81636-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All UBE2G2 Reagents
CRO Services
Product recommended

All UBE2G2 Reagents
UBE2G2 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
498 bp
Description
Full length Clone DNA of Rat ubiquitin-conjugating enzyme E2G 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UBE2G2 Background Information
Full Name
ubiquitin-conjugating enzyme E2G 2

UBE2G2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UBE2G2 cDNA ORF Clone in Cloning Vector, Rat RG81636-G
UBE2G2 cDNA ORF Clone, Rat, untagged RG81636-UT
UBE2G2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81636-ACG
UBE2G2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81636-ACGLN
UBE2G2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81636-ANG
UBE2G2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81636-ACR
UBE2G2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81636-ANR
UBE2G2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81636-CF
UBE2G2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81636-NF
UBE2G2 cDNA ORF Clone, Rat, C-His tag RG81636-CH
UBE2G2 cDNA ORF Clone, Rat, C-HA tag RG81636-CY
UBE2G2 cDNA ORF Clone, Rat, N-HA tag RG81636-NY
UBE2G2 cDNA ORF Clone, Rat, C-Myc tag RG81636-CM
UBE2G2 cDNA ORF Clone, Rat, N-Myc tag RG81636-NM

UBE2G2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UBE2G2 cDNA ORF Clone in Cloning Vector, Mouse MG53132-G
UBE2G2 cDNA ORF Clone, Mouse, untagged MG53132-UT
UBE2G2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53132-ACG
UBE2G2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53132-ACGLN
UBE2G2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53132-ANG
UBE2G2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53132-ACR
UBE2G2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53132-ANR
UBE2G2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53132-CF
UBE2G2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53132-NF
UBE2G2 cDNA ORF Clone, Mouse, C-His tag MG53132-CH
UBE2G2 cDNA ORF Clone, Mouse, N-His tag MG53132-NH
UBE2G2 cDNA ORF Clone, Mouse, C-HA tag MG53132-CY
UBE2G2 cDNA ORF Clone, Mouse, N-HA tag MG53132-NY
UBE2G2 cDNA ORF Clone, Mouse, C-Myc tag MG53132-CM
UBE2G2 cDNA ORF Clone, Mouse, N-Myc tag MG53132-NM

UBE2G2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UBE2G2 cDNA ORF Clone in Cloning Vector, Human HG12728-U
UBE2G2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12728-ACGLN
info info
添加购物车成功! 添加购物车失败!