TVP23B cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81329-NF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All TVP23B Reagents

CRO Services

Product recommended


All TVP23B Reagents

TVP23B cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Rat trans-golgi network vesicle protein 23 homolog B (S. cerevisiae) with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TVP23B cDNA ORF Clone, Rat, N-DDK (Flag®) tag Alternative Names

Fam18b2 cDNA ORF Clone, Rat

TVP23B Background Information

Full Name
trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)

TVP23B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TVP23B cDNA ORF Clone in Cloning Vector, Rat RG81329-U
TVP23B cDNA ORF Clone, Rat, untagged RG81329-UT
TVP23B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81329-ACGLN
TVP23B cDNA ORF Clone, Rat, C-GFPSpark® tag RG81329-ACG
TVP23B cDNA ORF Clone, Rat, C-OFPSpark® tag RG81329-ACR
TVP23B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81329-CF
TVP23B cDNA ORF Clone, Rat, C-His tag RG81329-CH
TVP23B cDNA ORF Clone, Rat, N-His tag RG81329-NH
TVP23B cDNA ORF Clone, Rat, C-HA tag RG81329-CY
TVP23B cDNA ORF Clone, Rat, N-HA tag RG81329-NY
TVP23B cDNA ORF Clone, Rat, C-Myc tag RG81329-CM
TVP23B cDNA ORF Clone, Rat, N-Myc tag RG81329-NM
TVP23B qPCR Primer Pairs, Rat RP301274

TVP23B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TVP23B cDNA ORF Clone in Cloning Vector, Mouse MG53204-G
TVP23B cDNA ORF Clone, Mouse, untagged MG53204-UT
TVP23B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53204-ACG
TVP23B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53204-ACGLN
TVP23B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53204-ACR
TVP23B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53204-CF
TVP23B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53204-NF
TVP23B cDNA ORF Clone, Mouse, C-His tag MG53204-CH
TVP23B cDNA ORF Clone, Mouse, N-His tag MG53204-NH
TVP23B cDNA ORF Clone, Mouse, C-HA tag MG53204-CY
TVP23B cDNA ORF Clone, Mouse, N-HA tag MG53204-NY
TVP23B cDNA ORF Clone, Mouse, C-Myc tag MG53204-CM
TVP23B cDNA ORF Clone, Mouse, N-Myc tag MG53204-NM

TVP23B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TVP23B cDNA ORF Clone in Cloning Vector, Human HG16425-G
TVP23B cDNA ORF Clone, Human, untagged HG16425-UT
TVP23B cDNA ORF Clone, Human, C-GFPSpark® tag HG16425-ACG
TVP23B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16425-ACGLN
TVP23B cDNA ORF Clone, Human, C-OFPSpark® tag HG16425-ACR
TVP23B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16425-CF
TVP23B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16425-NF
TVP23B cDNA ORF Clone, Human, C-His tag HG16425-CH
TVP23B cDNA ORF Clone, Human, N-His tag HG16425-NH
TVP23B cDNA ORF Clone, Human, C-HA tag HG16425-CY
TVP23B cDNA ORF Clone, Human, N-HA tag HG16425-NY
TVP23B cDNA ORF Clone, Human, C-Myc tag HG16425-CM
TVP23B cDNA ORF Clone, Human, N-Myc tag HG16425-NM
TVP23B qPCR Primer Pairs, Human HP105174
info info
添加购物车成功! 添加购物车失败!