TCF25 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81622-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TCF25 Reagents
CRO Services
Product recommended

All TCF25 Reagents
TCF25 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2034 bp
Description
Full length Clone DNA of Rat transcription factor 25 (basic helix-loop-helix) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TCF25 Background Information
Full Name
transcription factor 25 (basic helix-loop-helix)

TCF25 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TCF25 cDNA ORF Clone in Cloning Vector, Rat RG81622-G
TCF25 cDNA ORF Clone, Rat, untagged RG81622-UT
TCF25 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81622-ACGLN
TCF25 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81622-ACG
TCF25 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81622-ANG
TCF25 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81622-ACR
TCF25 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81622-ANR
TCF25 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81622-CF
TCF25 cDNA ORF Clone, Rat, C-His tag RG81622-CH
TCF25 cDNA ORF Clone, Rat, N-His tag RG81622-NH
TCF25 cDNA ORF Clone, Rat, C-HA tag RG81622-CY
TCF25 cDNA ORF Clone, Rat, N-HA tag RG81622-NY
TCF25 cDNA ORF Clone, Rat, C-Myc tag RG81622-CM
TCF25 cDNA ORF Clone, Rat, N-Myc tag RG81622-NM

TCF25 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TCF25 cDNA ORF Clone in Cloning Vector, Mouse MG52531-G
TCF25 cDNA ORF Clone, Mouse, untagged MG52531-UT
TCF25 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52531-ACG
TCF25 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52531-ACGLN
TCF25 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52531-ANG
TCF25 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52531-ACR
TCF25 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52531-ANR
TCF25 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52531-CF
TCF25 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52531-NF
TCF25 cDNA ORF Clone, Mouse, C-His tag MG52531-CH
TCF25 cDNA ORF Clone, Mouse, N-His tag MG52531-NH
TCF25 cDNA ORF Clone, Mouse, C-HA tag MG52531-CY
TCF25 cDNA ORF Clone, Mouse, N-HA tag MG52531-NY
TCF25 cDNA ORF Clone, Mouse, C-Myc tag MG52531-CM
TCF25 cDNA ORF Clone, Mouse, N-Myc tag MG52531-NM
TCF25 qPCR Primer Pairs, Mouse MP202404

TCF25 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TCF25 cDNA ORF Clone in Cloning Vector, Human HG17175-U
TCF25 cDNA ORF Clone, Human, untagged HG17175-UT
TCF25 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17175-ACGLN
TCF25 cDNA ORF Clone, Human, C-GFPSpark® tag HG17175-ACG
TCF25 cDNA ORF Clone, Human, N-GFPSpark® tag HG17175-ANG
TCF25 cDNA ORF Clone, Human, C-OFPSpark® tag HG17175-ACR
TCF25 cDNA ORF Clone, Human, N-OFPSpark® tag HG17175-ANR
TCF25 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17175-CF
TCF25 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17175-NF
TCF25 cDNA ORF Clone, Human, C-His tag HG17175-CH
TCF25 cDNA ORF Clone, Human, N-His tag HG17175-NH
TCF25 cDNA ORF Clone, Human, C-HA tag HG17175-CY
TCF25 cDNA ORF Clone, Human, N-HA tag HG17175-NY
TCF25 cDNA ORF Clone, Human, C-Myc tag HG17175-CM
TCF25 cDNA ORF Clone, Human, N-Myc tag HG17175-NM
info info
添加购物车成功! 添加购物车失败!