TCEB1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81605-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TCEB1 Reagents
CRO Services
Product recommended

All TCEB1 Reagents
TCEB1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
339 bp
Description
Full length Clone DNA of Rat transcription elongation factor B (SIII), polypeptide 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TCEB1 Background Information
Full Name
transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)

TCEB1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TCEB1 cDNA ORF Clone in Cloning Vector, Rat RG81605-G
TCEB1 cDNA ORF Clone, Rat, untagged RG81605-UT
TCEB1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81605-ACGLN
TCEB1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81605-ACG
TCEB1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81605-ACR
TCEB1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81605-CF
TCEB1 cDNA ORF Clone, Rat, C-His tag RG81605-CH
TCEB1 cDNA ORF Clone, Rat, N-His tag RG81605-NH
TCEB1 cDNA ORF Clone, Rat, C-HA tag RG81605-CY
TCEB1 cDNA ORF Clone, Rat, N-HA tag RG81605-NY
TCEB1 cDNA ORF Clone, Rat, C-Myc tag RG81605-CM
TCEB1 cDNA ORF Clone, Rat, N-Myc tag RG81605-NM

TCEB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TCEB1 cDNA ORF Clone in Cloning Vector, Mouse MG53450-U
TCEB1 cDNA ORF Clone, Mouse, untagged MG53450-UT
TCEB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53450-ACGLN
TCEB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53450-ACG
TCEB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53450-ANG
TCEB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53450-ACR
TCEB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53450-ANR
TCEB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53450-CF
TCEB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53450-NF
TCEB1 cDNA ORF Clone, Mouse, C-His tag MG53450-CH
TCEB1 cDNA ORF Clone, Mouse, N-His tag MG53450-NH
TCEB1 cDNA ORF Clone, Mouse, C-HA tag MG53450-CY
TCEB1 cDNA ORF Clone, Mouse, N-HA tag MG53450-NY
TCEB1 cDNA ORF Clone, Mouse, C-Myc tag MG53450-CM
TCEB1 cDNA ORF Clone, Mouse, N-Myc tag MG53450-NM

TCEB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TCEB1 cDNA ORF Clone in Cloning Vector, Human HG16968-U
TCEB1 cDNA ORF Clone, Human, untagged HG16968-UT
TCEB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16968-ACG
TCEB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16968-ACGLN
TCEB1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16968-ANG
TCEB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16968-ACR
TCEB1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16968-ANR
TCEB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16968-CF
TCEB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16968-NF
TCEB1 cDNA ORF Clone, Human, C-His tag HG16968-CH
TCEB1 cDNA ORF Clone, Human, N-His tag HG16968-NH
TCEB1 cDNA ORF Clone, Human, C-HA tag HG16968-CY
TCEB1 cDNA ORF Clone, Human, N-HA tag HG16968-NY
TCEB1 cDNA ORF Clone, Human, C-Myc tag HG16968-CM
TCEB1 cDNA ORF Clone, Human, N-Myc tag HG16968-NM
info info
添加购物车成功! 添加购物车失败!