SSR3 cDNA ORF Clone, Rat, untagged

Cat: RG81016-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SSR3 Reagents
CRO Services
Product recommended

All SSR3 Reagents
SSR3 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
558 bp
Description
Full length Clone DNA of Rat signal sequence receptor, gamma.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SSR3 Background Information
Full Name
signal sequence receptor, gamma (translocon-associated protein gamma)

SSR3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SSR3 cDNA ORF Clone in Cloning Vector, Rat RG81016-U
SSR3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81016-ACGLN
SSR3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81016-ACG
SSR3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81016-ACR
SSR3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81016-CF
SSR3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81016-NF
SSR3 cDNA ORF Clone, Rat, C-His tag RG81016-CH
SSR3 cDNA ORF Clone, Rat, N-His tag RG81016-NH
SSR3 cDNA ORF Clone, Rat, C-HA tag RG81016-CY
SSR3 cDNA ORF Clone, Rat, N-HA tag RG81016-NY
SSR3 cDNA ORF Clone, Rat, C-Myc tag RG81016-CM
SSR3 cDNA ORF Clone, Rat, N-Myc tag RG81016-NM
SSR3 qPCR Primer Pairs, Rat RP300980

SSR3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SSR3 cDNA ORF Clone in Cloning Vector, Mouse MG5A4737-U
SSR3 cDNA ORF Clone, Mouse, untagged MG5A4737-UT
SSR3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4737-ACGLN
SSR3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4737-ACG
SSR3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4737-ANG
SSR3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4737-ACR
SSR3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4737-ANR
SSR3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4737-CF
SSR3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4737-NF
SSR3 cDNA ORF Clone, Mouse, C-His tag MG5A4737-CH
SSR3 cDNA ORF Clone, Mouse, N-His tag MG5A4737-NH
SSR3 cDNA ORF Clone, Mouse, C-HA tag MG5A4737-CY
SSR3 cDNA ORF Clone, Mouse, N-HA tag MG5A4737-NY
SSR3 cDNA ORF Clone, Mouse, C-Myc tag MG5A4737-CM
SSR3 cDNA ORF Clone, Mouse, N-Myc tag MG5A4737-NM

SSR3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SSR3 cDNA ORF Clone in Cloning Vector, Human HG23662-U
SSR3 cDNA ORF Clone, Human, untagged HG23662-UT
SSR3 cDNA ORF Clone, Human, C-GFPSpark® tag HG23662-ACG
SSR3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23662-ACGLN
SSR3 cDNA ORF Clone, Human, C-OFPSpark® tag HG23662-ACR
SSR3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23662-CF
SSR3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23662-NF
SSR3 cDNA ORF Clone, Human, C-His tag HG23662-CH
SSR3 cDNA ORF Clone, Human, N-His tag HG23662-NH
SSR3 cDNA ORF Clone, Human, C-HA tag HG23662-CY
SSR3 cDNA ORF Clone, Human, N-HA tag HG23662-NY
SSR3 cDNA ORF Clone, Human, C-Myc tag HG23662-CM
SSR3 cDNA ORF Clone, Human, N-Myc tag HG23662-NM
info info
添加购物车成功! 添加购物车失败!