SKAP2 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81123-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SKAP2 Reagents
CRO Services
Product recommended

All SKAP2 Reagents
SKAP2 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1077 bp
Description
Full length Clone DNA of Rat src kinase associated phosphoprotein 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SKAP2 Background Information
Full Name
src kinase associated phosphoprotein 2

SKAP2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SKAP2 cDNA ORF Clone in Cloning Vector, Rat RG81123-U
SKAP2 cDNA ORF Clone, Rat, untagged RG81123-UT
SKAP2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81123-ACGLN
SKAP2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81123-ACG
SKAP2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81123-ANG
SKAP2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81123-ACR
SKAP2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81123-ANR
SKAP2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81123-CF
SKAP2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81123-NF
SKAP2 cDNA ORF Clone, Rat, C-His tag RG81123-CH
SKAP2 cDNA ORF Clone, Rat, N-His tag RG81123-NH
SKAP2 cDNA ORF Clone, Rat, C-HA tag RG81123-CY
SKAP2 cDNA ORF Clone, Rat, N-HA tag RG81123-NY
SKAP2 cDNA ORF Clone, Rat, N-Myc tag RG81123-NM
SKAP2 qPCR Primer Pairs, Rat RP301080

SKAP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SKAP2 cDNA ORF Clone in Cloning Vector, Mouse MG53375-U
SKAP2 cDNA ORF Clone, Mouse, untagged MG53375-UT
SKAP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53375-ACG
SKAP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53375-ACGLN
SKAP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53375-ANG
SKAP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53375-ACR
SKAP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53375-ANR
SKAP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53375-CF
SKAP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53375-NF
SKAP2 cDNA ORF Clone, Mouse, C-His tag MG53375-CH
SKAP2 cDNA ORF Clone, Mouse, N-His tag MG53375-NH
SKAP2 cDNA ORF Clone, Mouse, C-HA tag MG53375-CY
SKAP2 cDNA ORF Clone, Mouse, N-HA tag MG53375-NY
SKAP2 cDNA ORF Clone, Mouse, C-Myc tag MG53375-CM
SKAP2 cDNA ORF Clone, Mouse, N-Myc tag MG53375-NM

SKAP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SKAP2 cDNA ORF Clone in Cloning Vector, Human HG17150-U
SKAP2 cDNA ORF Clone, Human, untagged HG17150-UT
SKAP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG17150-ACG
SKAP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17150-ACGLN
SKAP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG17150-ANG
SKAP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG17150-ACR
SKAP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG17150-ANR
SKAP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17150-CF
SKAP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17150-NF
SKAP2 cDNA ORF Clone, Human, C-His tag HG17150-CH
SKAP2 cDNA ORF Clone, Human, N-His tag HG17150-NH
SKAP2 cDNA ORF Clone, Human, C-HA tag HG17150-CY
SKAP2 cDNA ORF Clone, Human, N-HA tag HG17150-NY
SKAP2 cDNA ORF Clone, Human, C-Myc tag HG17150-CM
SKAP2 cDNA ORF Clone, Human, N-Myc tag HG17150-NM
info info
添加购物车成功! 添加购物车失败!