SIN3B cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80702-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SIN3B Reagents
CRO Services
Product recommended

All SIN3B Reagents
SIN3B cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Rat SIN3 homolog B, transcription regulator (yeast) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIN3B Background Information
Full Name
SIN3 transcription regulator family member B

SIN3B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SIN3B cDNA ORF Clone in Cloning Vector, Rat RG80702-U
SIN3B cDNA ORF Clone, Rat, untagged RG80702-UT
SIN3B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80702-ACGLN
SIN3B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80702-ACG
SIN3B cDNA ORF Clone, Rat, N-GFPSpark® tag RG80702-ANG
SIN3B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80702-ACR
SIN3B cDNA ORF Clone, Rat, N-OFPSpark® tag RG80702-ANR
SIN3B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80702-CF
SIN3B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80702-NF
SIN3B cDNA ORF Clone, Rat, C-His tag RG80702-CH
SIN3B cDNA ORF Clone, Rat, N-His tag RG80702-NH
SIN3B cDNA ORF Clone, Rat, C-HA tag RG80702-CY
SIN3B cDNA ORF Clone, Rat, N-HA tag RG80702-NY
SIN3B cDNA ORF Clone, Rat, C-Myc tag RG80702-CM
SIN3B qPCR Primer Pairs, Rat RP300666

SIN3B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SIN3B cDNA ORF Clone in Cloning Vector, Mouse MG58718-U
SIN3B cDNA ORF Clone, Mouse, untagged MG58718-UT
SIN3B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58718-ACG
SIN3B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58718-ACGLN
SIN3B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58718-ANG
SIN3B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58718-ACR
SIN3B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58718-ANR
SIN3B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58718-CF
SIN3B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58718-NF
SIN3B cDNA ORF Clone, Mouse, C-His tag MG58718-CH
SIN3B cDNA ORF Clone, Mouse, N-His tag MG58718-NH
SIN3B cDNA ORF Clone, Mouse, C-HA tag MG58718-CY
SIN3B cDNA ORF Clone, Mouse, N-HA tag MG58718-NY
SIN3B cDNA ORF Clone, Mouse, C-Myc tag MG58718-CM
SIN3B cDNA ORF Clone, Mouse, N-Myc tag MG58718-NM

SIN3B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SIN3B cDNA ORF Clone, Human, untagged HG19444-UT
info info
添加购物车成功! 添加购物车失败!