alpha 1 Antitrypsin cDNA ORF Clone, Rat, N-HA tag

Cat: RG80476-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All alpha 1 Antitrypsin Reagents
CRO Services
Product recommended

All alpha 1 Antitrypsin Reagents
alpha 1 Antitrypsin cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1236 bp
Description
Full length Clone DNA of Rat serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alpha 1 Antitrypsin cDNA ORF Clone, Rat, N-HA tag Alternative Names
SerpinA1 cDNA ORF Clone, Rat
alpha 1 Antitrypsin Background Information

SerpinA1, also known as Alpha-1 antitrypsin (AAT), is a prototype member of the Serpin superfamily of the serine protease inhibitors. This serine protease inhibitor blocks the protease, neutrophil elastase. Alpha-1 antitrypsin is mainly produced in the liver and acts as an antiprotease. Its principal function is to inactivate neutrophil elastase, preventing tissue damage. SerpinA1 (alpha1-antitrypsin), an acute phase protein and the classical neutrophil elastase inhibitor, is localized within lipid rafts in primary human monocytes in vitro. It association with monocytes is inhibited by cholesterol depleting/efflux-stimulating agents (nystatin, filipin, MbetaCD (methyl-beta-cyclodextrin) and oxidized low-density lipoprotein (oxLDL) and conversely, enhanced by free cholesterol. Furthermore, SerpinA1/monocyte association per se depletes lipid raft cholesterol as characterized by the activation of extracellular signal-regulated kinase 2, formation of cytosolic lipid droplets, and a complete inhibition of oxLDL uptake by monocytes. Previous population studies have suggested that heterozygote status for the AAT gene (SerpinA1) is a risk factor for chronic rhinosinusitis with nasal polyposis (CRSwNP). Alpha-1 antitrypsin deficiency is a recently identified genetic disease that occurs almost as frequently as cystic fibrosis. It is caused by various mutations in the SerpinA1 gene, and has numerous clinical implications. Alpha-1 antitrypsin deficiency is an inherited disease affecting the lung and liver. In the liver, alpha-1 antitrypsin deficiency may manifest as benign neonatal hepatitis syndrome; a small percentage of adults develop liver fibrosis, with progression to cirrhosis and hepatocellular carcinoma. Its most important physiologic functions are the protection of pulmonary tissue from aggressive proteolytic enzymes and regulation of pulmonary immune processes.

Full Name
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1
References
  • Khnlein T, et al. (2008) Alpha-1 antitrypsin deficiency: pathogenesis, clinical presentation, diagnosis, and treatment. Am J Med. 121(1): 3-9.
  • Camelier AA, et al. (2008) Alpha-1 antitrypsin deficiency: diagnosis and treatment. J Bras Pneumol. 34(7): 514-27.
  • Subramaniyam D, et al. (2010) Cholesterol rich lipid raft microdomains are gateway for acute phase protein, SERPINA1. Int J Biochem Cell Biol. 42(9): 1562-70.
  • Kilty SJ, et al. (2010) Polymorphisms in the SERPINA1 (Alpha-1-Antitrypsin) gene are associated with severe chronic rhinosinusitis unresponsive to medical therapy. Am J Rhinol Allergy. 24(1): e4-9.
  • alpha 1 Antitrypsin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    alpha 1 Antitrypsin cDNA ORF Clone in Cloning Vector, Rat RG80476-U
    alpha 1 Antitrypsin cDNA ORF Clone, Rat, untagged RG80476-UT
    alpha 1 Antitrypsin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80476-ACGLN
    alpha 1 Antitrypsin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80476-ACG
    alpha 1 Antitrypsin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80476-ACR
    alpha 1 Antitrypsin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80476-CF
    alpha 1 Antitrypsin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80476-NF
    alpha 1 Antitrypsin cDNA ORF Clone, Rat, C-His tag RG80476-CH
    alpha 1 Antitrypsin cDNA ORF Clone, Rat, N-His tag RG80476-NH
    alpha 1 Antitrypsin cDNA ORF Clone, Rat, C-HA tag RG80476-CY
    alpha 1 Antitrypsin cDNA ORF Clone, Rat, C-Myc tag RG80476-CM
    alpha 1 Antitrypsin cDNA ORF Clone, Rat, N-Myc tag RG80476-NM
    alpha 1 Antitrypsin qPCR Primer Pairs, Rat RP300440

    alpha 1 Antitrypsin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    alpha 1 Antitrypsin cDNA ORF Clone in Cloning Vector, Human HG10306-M
    alpha 1 Antitrypsin cDNA ORF Clone in Cloning Vector, Human HG17002-U
    alpha 1 Antitrypsin cDNA ORF Clone, Human, untagged HG10306-UT
    alpha 1 Antitrypsin cDNA ORF Clone, Human, untagged HG17002-UT
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-GFPSpark® tag HG17002-ACG
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-GFPSpark® tag HG10306-ACG
    alpha 1 Antitrypsin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10306-ACGLN
    alpha 1 Antitrypsin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17002-ACGLN
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-OFPSpark® tag HG17002-ACR
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-OFPSpark® tag HG10306-ACR
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17002-CF
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10306-CF
    alpha 1 Antitrypsin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17002-NF
    alpha 1 Antitrypsin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10306-NF
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-His tag HG10306-CH
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-His tag HG17002-CH
    alpha 1 Antitrypsin cDNA ORF Clone, Human, N-His tag HG10306-NH
    alpha 1 Antitrypsin cDNA ORF Clone, Human, N-His tag HG17002-NH
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-HA tag HG17002-CY
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-HA tag HG10306-CY
    alpha 1 Antitrypsin cDNA ORF Clone, Human, N-HA tag HG10306-NY
    alpha 1 Antitrypsin cDNA ORF Clone, Human, N-HA tag HG17002-NY
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-Myc tag HG17002-CM
    alpha 1 Antitrypsin cDNA ORF Clone, Human, C-Myc tag HG10306-CM
    alpha 1 Antitrypsin cDNA ORF Clone, Human, N-Myc tag HG17002-NM
    alpha 1 Antitrypsin cDNA ORF Clone, Human, N-Myc tag HG10306-NM
    alpha 1 Antitrypsin qPCR Primer Pairs, Human HP100349
    info info
    添加购物车成功! 添加购物车失败!