RRM1 cDNA ORF Clone, Rat, C-His tag

Cat: RG81060-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RRM1 Reagents
CRO Services
Product recommended

All RRM1 Reagents
RRM1 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2379 bp
Description
Full length Clone DNA of Rat ribonucleotide reductase M1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RRM1 Background Information

RRM1 is a subunit of ribonucleoside-diphosphate reductase which is constituted by two subunits. Ribonucleoside-diphosphate reductase is an enzyme essential for the production of deoxyribonucleotides prior to DNA synthesis in S phase of dividing cells. RRM1 is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. RRM1 may play a role in malignancies and disease that involve this region.

Full Name
ribonucleotide reductase M1
References
  • Pitterle DM, et al. (1999) Human gene for the large subunit of ribonucleotide reductase (RRM1): functional analysis of the promoter. Genomics. 27(2):280-5.
  • Parker NJ, et al. (1995) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Gautam A, et al. (2003) RRM1-induced metastasis suppression through PTEN-regulated pathways. Oncogene. 22(14):2135-42.
  • RRM1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    RRM1 cDNA ORF Clone in Cloning Vector, Rat RG81060-U
    RRM1 cDNA ORF Clone, Rat, untagged RG81060-UT
    RRM1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81060-ACG
    RRM1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81060-ACGLN
    RRM1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81060-ANG
    RRM1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81060-ACR
    RRM1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81060-ANR
    RRM1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81060-CF
    RRM1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81060-NF
    RRM1 cDNA ORF Clone, Rat, N-His tag RG81060-NH
    RRM1 cDNA ORF Clone, Rat, C-HA tag RG81060-CY
    RRM1 cDNA ORF Clone, Rat, N-HA tag RG81060-NY
    RRM1 cDNA ORF Clone, Rat, C-Myc tag RG81060-CM
    RRM1 cDNA ORF Clone, Rat, N-Myc tag RG81060-NM
    RRM1 qPCR Primer Pairs, Rat RP301024

    RRM1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RRM1 cDNA ORF Clone in Cloning Vector, Human HG14316-G
    RRM1 cDNA ORF Clone, Human, untagged HG14316-UT
    RRM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14316-ACGLN
    RRM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14316-ACG
    RRM1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14316-ANG
    RRM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14316-ACR
    RRM1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14316-ANR
    RRM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14316-CF
    RRM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14316-NF
    RRM1 cDNA ORF Clone, Human, C-His tag HG14316-CH
    RRM1 cDNA ORF Clone, Human, N-His tag HG14316-NH
    RRM1 cDNA ORF Clone, Human, C-HA tag HG14316-CY
    RRM1 cDNA ORF Clone, Human, N-HA tag HG14316-NY
    RRM1 cDNA ORF Clone, Human, C-Myc tag HG14316-CM
    RRM1 cDNA ORF Clone, Human, N-Myc tag HG14316-NM
    RRM1 qPCR Primer Pairs, Human HP102966
    info info
    添加购物车成功! 添加购物车失败!