RGS19 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80740-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RGS19 Reagents
CRO Services
Product recommended

All RGS19 Reagents
RGS19 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
651 bp
Description
Full length Clone DNA of Rat regulator of G-protein signaling 19 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RGS19 Background Information
Full Name
regulator of G-protein signaling 19

RGS19 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RGS19 cDNA ORF Clone in Cloning Vector, Rat RG80740-U
RGS19 cDNA ORF Clone, Rat, untagged RG80740-UT
RGS19 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80740-ACG
RGS19 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80740-ACGLN
RGS19 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80740-ANG
RGS19 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80740-ACR
RGS19 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80740-ANR
RGS19 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80740-CF
RGS19 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80740-NF
RGS19 cDNA ORF Clone, Rat, C-His tag RG80740-CH
RGS19 cDNA ORF Clone, Rat, N-His tag RG80740-NH
RGS19 cDNA ORF Clone, Rat, C-HA tag RG80740-CY
RGS19 cDNA ORF Clone, Rat, N-HA tag RG80740-NY
RGS19 cDNA ORF Clone, Rat, C-Myc tag RG80740-CM
RGS19 qPCR Primer Pairs, Rat RP300704

RGS19 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RGS19 cDNA ORF Clone in Cloning Vector, Mouse MG53049-G
RGS19 cDNA ORF Clone, Mouse, untagged MG53049-UT
RGS19 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53049-ACGLN
RGS19 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53049-ACG
RGS19 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53049-ANG
RGS19 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53049-ACR
RGS19 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53049-ANR
RGS19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53049-CF
RGS19 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53049-NF
RGS19 cDNA ORF Clone, Mouse, C-His tag MG53049-CH
RGS19 cDNA ORF Clone, Mouse, N-His tag MG53049-NH
RGS19 cDNA ORF Clone, Mouse, C-HA tag MG53049-CY
RGS19 cDNA ORF Clone, Mouse, N-HA tag MG53049-NY
RGS19 cDNA ORF Clone, Mouse, C-Myc tag MG53049-CM
RGS19 cDNA ORF Clone, Mouse, N-Myc tag MG53049-NM

RGS19 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RGS19 cDNA ORF Clone in Cloning Vector, Human HG19647-U
info info
添加购物车成功! 添加购物车失败!