Nectin-2 cDNA ORF Clone, Rat, C-His tag

Cat: RG80327-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Nectin-2 Reagents
CRO Services
Product recommended

All Nectin-2 Reagents
Nectin-2 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1593 bp
Description
Full length Clone DNA of Rat poliovirus receptor-related 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Nectin-2 Background Information

Cluster of Differentiation 112 (CD112), also known as poliovirus receptor related protein 2 (PVRL2 or PRR2), is a single-pass type I transmembrane glycoprotein belonging to the Immunoglobulin superfamily. CD112 protein also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and thus is involved in cell to cell spreading of these viruses. CD112 protein has been identified as the ligand for DNAM-1 (CD226), and the interaction of CD226/CD112 protein can induce NK cell- and CD8+ T cell-mediated cytotoxicity and cytokine secretion. CD112 has been regarded as a critical component in allergic reactions, and accordingly may function as a novel target for anti-allergic therapy.

Full Name
poliovirus receptor-related 2 (herpesvirus entry mediator B)
References
  • Bachelet I, et al. (2006) Mast cell costimulation by CD226/CD112 (DNAM-1/Nectin-2): a novel interface in the allergic process. J Biol Chem. 281(37): 27190-6.
  • Wang L, et al. (2009) Molecular cloning, characterization and three-dimensional modeling of porcine nectin-2/CD112. Vet Immunol Immunopathol. 132(2-4): 257-63.
  • Nectin-2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Nectin-2 cDNA ORF Clone in Cloning Vector, Rat RG80327-G
    Nectin-2 cDNA ORF Clone, Rat, untagged RG80327-UT
    Nectin-2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80327-ACGLN
    Nectin-2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80327-ACG
    Nectin-2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80327-ACR
    Nectin-2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80327-CF
    Nectin-2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80327-NF
    Nectin-2 cDNA ORF Clone, Rat, N-His tag RG80327-NH
    Nectin-2 cDNA ORF Clone, Rat, C-HA tag RG80327-CY
    Nectin-2 cDNA ORF Clone, Rat, N-HA tag RG80327-NY
    Nectin-2 cDNA ORF Clone, Rat, C-Myc tag RG80327-CM
    Nectin-2 cDNA ORF Clone, Rat, N-Myc tag RG80327-NM
    Nectin-2 qPCR Primer Pairs, Rat RP300298

    Nectin-2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Nectin-2 cDNA ORF Clone in Cloning Vector, Mouse MG50318-M
    Nectin-2 cDNA ORF Clone, Mouse, untagged MG50318-UT
    Nectin-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50318-ACG
    Nectin-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50318-ACGLN
    Nectin-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50318-ACR
    Nectin-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50318-CF
    Nectin-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50318-NF
    Nectin-2 cDNA ORF Clone, Mouse, C-His tag MG50318-CH
    Nectin-2 cDNA ORF Clone, Mouse, N-His tag MG50318-NH
    Nectin-2 cDNA ORF Clone, Mouse, C-HA tag MG50318-CY
    Nectin-2 cDNA ORF Clone, Mouse, N-HA tag MG50318-NY
    Nectin-2 cDNA ORF Clone, Mouse, C-Myc tag MG50318-CM
    Nectin-2 cDNA ORF Clone, Mouse, N-Myc tag MG50318-NM
    Nectin-2 qPCR Primer Pairs, Mouse MP200341

    Nectin-2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Nectin-2 cDNA ORF Clone in Cloning Vector, Human HG10005-G
    Nectin-2 cDNA ORF Clone, Human, untagged HG10005-UT
    Nectin-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10005-ACG
    Nectin-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10005-ACGLN
    Nectin-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10005-ACR
    Nectin-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10005-CF
    Nectin-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10005-NF
    Nectin-2 cDNA ORF Clone, Human, C-His tag HG10005-CH
    Nectin-2 cDNA ORF Clone, Human, N-His tag HG10005-NH
    Nectin-2 cDNA ORF Clone, Human, C-HA tag HG10005-CY
    Nectin-2 cDNA ORF Clone, Human, N-HA tag HG10005-NY
    Nectin-2 cDNA ORF Clone, Human, C-Myc tag HG10005-CM
    Nectin-2 cDNA ORF Clone, Human, N-Myc tag HG10005-NM
    Nectin-2 qPCR Primer Pairs, Human HP100092
    info info
    添加购物车成功! 添加购物车失败!