PSMB3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81335-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PSMB3 Reagents
CRO Services
Product recommended

All PSMB3 Reagents
PSMB3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Rat proteasome (prosome, macropain) subunit, beta type 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMB3 Background Information
Full Name
proteasome (prosome, macropain) subunit, beta type, 3

PSMB3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMB3 cDNA ORF Clone in Cloning Vector, Rat RG81335-G
PSMB3 cDNA ORF Clone, Rat, untagged RG81335-UT
PSMB3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81335-ACG
PSMB3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81335-ACGLN
PSMB3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81335-ANG
PSMB3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81335-ACR
PSMB3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81335-ANR
PSMB3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81335-CF
PSMB3 cDNA ORF Clone, Rat, C-His tag RG81335-CH
PSMB3 cDNA ORF Clone, Rat, N-His tag RG81335-NH
PSMB3 cDNA ORF Clone, Rat, C-HA tag RG81335-CY
PSMB3 cDNA ORF Clone, Rat, N-HA tag RG81335-NY
PSMB3 cDNA ORF Clone, Rat, C-Myc tag RG81335-CM
PSMB3 cDNA ORF Clone, Rat, N-Myc tag RG81335-NM
PSMB3 qPCR Primer Pairs, Rat RP301281

PSMB3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMB3 cDNA ORF Clone in Cloning Vector, Mouse MG53905-U
PSMB3 cDNA ORF Clone, Mouse, untagged MG53905-UT
PSMB3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53905-ACGLN
PSMB3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53905-ACG
PSMB3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53905-ANG
PSMB3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53905-ACR
PSMB3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53905-ANR
PSMB3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53905-CF
PSMB3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53905-NF
PSMB3 cDNA ORF Clone, Mouse, C-His tag MG53905-CH
PSMB3 cDNA ORF Clone, Mouse, N-His tag MG53905-NH
PSMB3 cDNA ORF Clone, Mouse, C-HA tag MG53905-CY
PSMB3 cDNA ORF Clone, Mouse, N-HA tag MG53905-NY
PSMB3 cDNA ORF Clone, Mouse, C-Myc tag MG53905-CM
PSMB3 cDNA ORF Clone, Mouse, N-Myc tag MG53905-NM

PSMB3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMB3 cDNA ORF Clone in Cloning Vector, Human HG16730-U
PSMB3 cDNA ORF Clone, Human, untagged HG16730-UT
PSMB3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16730-ACG
PSMB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16730-ACGLN
PSMB3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16730-ANG
PSMB3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16730-ACR
PSMB3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16730-ANR
PSMB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16730-CF
PSMB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16730-NF
PSMB3 cDNA ORF Clone, Human, C-His tag HG16730-CH
PSMB3 cDNA ORF Clone, Human, N-His tag HG16730-NH
PSMB3 cDNA ORF Clone, Human, C-HA tag HG16730-CY
PSMB3 cDNA ORF Clone, Human, N-HA tag HG16730-NY
PSMB3 cDNA ORF Clone, Human, C-Myc tag HG16730-CM
PSMB3 cDNA ORF Clone, Human, N-Myc tag HG16730-NM
info info
添加购物车成功! 添加购物车失败!