CD133 cDNA ORF Clone, Rat, C-His tag

Cat: RG80324-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD133 Reagents
CRO Services
Product recommended

All CD133 Reagents
CD133 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2481 bp
Description
Full length Clone DNA of Rat prominin 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD133 Background Information

CD133, also known as PROM1 and Prominin 1, is a pentaspan transmembrane glycoprotein which belongs to the prominin family. It localizes to membrane protrusions and is often expressed on adult stem cells. CD133 is known to play a role in maintaining stem cell properties by suppressing differentiation. CD133 binds cholesterol in cholesterol-containing plasma membrane microdomains. It is proposed to play a role in apical plasma membrane organization of epithelial cells. CD133 is also involved in regulation of MAPK and Akt signaling pathways. Mutations in PROM1 gene have been shown to result in retinitis pigmentosa and Stargardt disease. PROM1 gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Expression of this gene is also associated with several types of cancer.

Full Name
prominin 1
References
  • Corbeil D. et al., 2001, Biochem Biophys Res Commun. 285 (4): 939-44.
  • Horn PA. et al., 1999, Blood. 93 (4): 1435-37.
  • Sanai N. et al., 2005, N Engl J Med. 353 (8): 811-22.
  • CD133 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD133 cDNA ORF Clone in Cloning Vector, Rat RG80324-G
    CD133 cDNA ORF Clone, Rat, untagged RG80324-UT
    CD133 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80324-ACGLN
    CD133 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80324-ACG
    CD133 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80324-ACR
    CD133 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80324-CF
    CD133 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80324-NF
    CD133 cDNA ORF Clone, Rat, N-His tag RG80324-NH
    CD133 cDNA ORF Clone, Rat, C-HA tag RG80324-CY
    CD133 cDNA ORF Clone, Rat, N-HA tag RG80324-NY
    CD133 cDNA ORF Clone, Rat, C-Myc tag RG80324-CM
    CD133 cDNA ORF Clone, Rat, N-Myc tag RG80324-NM
    CD133 qPCR Primer Pairs, Rat RP300295

    CD133 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD133 cDNA ORF Clone in Cloning Vector, Mouse MG57703-U
    CD133 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57703-ACGLN

    CD133 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD133 cDNA ORF Clone in Cloning Vector, Human HG15024-G
    CD133 cDNA ORF Clone, Human, untagged HG15024-UT
    CD133 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15024-ACGLN
    CD133 cDNA ORF Clone, Human, C-GFPSpark® tag HG15024-ACG
    CD133 cDNA ORF Clone, Human, C-OFPSpark® tag HG15024-ACR
    CD133 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15024-CF
    CD133 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15024-NF
    CD133 cDNA ORF Clone, Human, C-His tag HG15024-CH
    CD133 cDNA ORF Clone, Human, N-His tag HG15024-NH
    CD133 cDNA ORF Clone, Human, C-HA tag HG15024-CY
    CD133 cDNA ORF Clone, Human, N-HA tag HG15024-NY
    CD133 cDNA ORF Clone, Human, C-Myc tag HG15024-CM
    CD133 cDNA ORF Clone, Human, N-Myc tag HG15024-NM
    CD133 qPCR Primer Pairs, Human HP103652
    info info
    添加购物车成功! 添加购物车失败!