PPP2R1A cDNA ORF Clone, Rat, untagged

Cat: RG81015-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PPP2R1A Reagents
CRO Services
Product recommended

All PPP2R1A Reagents
PPP2R1A cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1770 bp
Description
Full length Clone DNA of Rat protein phosphatase 2, regulatory subunit A, alpha.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PPP2R1A Background Information
Full Name
protein phosphatase 2, regulatory subunit A, alpha

PPP2R1A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PPP2R1A cDNA ORF Clone in Cloning Vector, Rat RG81015-U
PPP2R1A cDNA ORF Clone, Rat, C-GFPSpark® tag RG81015-ACG
PPP2R1A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81015-ACGLN
PPP2R1A cDNA ORF Clone, Rat, N-GFPSpark® tag RG81015-ANG
PPP2R1A cDNA ORF Clone, Rat, C-OFPSpark® tag RG81015-ACR
PPP2R1A cDNA ORF Clone, Rat, N-OFPSpark® tag RG81015-ANR
PPP2R1A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81015-CF
PPP2R1A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81015-NF
PPP2R1A cDNA ORF Clone, Rat, C-His tag RG81015-CH
PPP2R1A cDNA ORF Clone, Rat, N-His tag RG81015-NH
PPP2R1A cDNA ORF Clone, Rat, C-HA tag RG81015-CY
PPP2R1A cDNA ORF Clone, Rat, N-HA tag RG81015-NY
PPP2R1A cDNA ORF Clone, Rat, C-Myc tag RG81015-CM
PPP2R1A cDNA ORF Clone, Rat, N-Myc tag RG81015-NM
PPP2R1A qPCR Primer Pairs, Rat RP300979

PPP2R1A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PPP2R1A cDNA ORF Clone in Cloning Vector, Human HG16756-U
PPP2R1A cDNA ORF Clone, Human, untagged HG16756-UT
PPP2R1A cDNA ORF Clone, Human, C-GFPSpark® tag HG16756-ACG
PPP2R1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16756-ACGLN
PPP2R1A cDNA ORF Clone, Human, N-GFPSpark® tag HG16756-ANG
PPP2R1A cDNA ORF Clone, Human, C-OFPSpark® tag HG16756-ACR
PPP2R1A cDNA ORF Clone, Human, N-OFPSpark® tag HG16756-ANR
PPP2R1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16756-CF
PPP2R1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16756-NF
PPP2R1A cDNA ORF Clone, Human, C-His tag HG16756-CH
PPP2R1A cDNA ORF Clone, Human, N-His tag HG16756-NH
PPP2R1A cDNA ORF Clone, Human, C-HA tag HG16756-CY
PPP2R1A cDNA ORF Clone, Human, N-HA tag HG16756-NY
PPP2R1A cDNA ORF Clone, Human, C-Myc tag HG16756-CM
PPP2R1A cDNA ORF Clone, Human, N-Myc tag HG16756-NM
info info
添加购物车成功! 添加购物车失败!