POLR2E cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80714-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All POLR2E Reagents
CRO Services
Product recommended

All POLR2E Reagents
POLR2E cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
633 bp
Description
Full length Clone DNA of Rat polymerase (RNA) II (DNA directed) polypeptide E with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

POLR2E Background Information
Full Name
polymerase (RNA) II (DNA directed) polypeptide E, 25kDa

POLR2E cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
POLR2E cDNA ORF Clone in Cloning Vector, Rat RG80714-U
POLR2E cDNA ORF Clone, Rat, untagged RG80714-UT
POLR2E Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80714-ACGLN
POLR2E cDNA ORF Clone, Rat, C-GFPSpark® tag RG80714-ACG
POLR2E cDNA ORF Clone, Rat, N-GFPSpark® tag RG80714-ANG
POLR2E cDNA ORF Clone, Rat, C-OFPSpark® tag RG80714-ACR
POLR2E cDNA ORF Clone, Rat, N-OFPSpark® tag RG80714-ANR
POLR2E cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80714-CF
POLR2E cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80714-NF
POLR2E cDNA ORF Clone, Rat, C-His tag RG80714-CH
POLR2E cDNA ORF Clone, Rat, N-His tag RG80714-NH
POLR2E cDNA ORF Clone, Rat, C-HA tag RG80714-CY
POLR2E cDNA ORF Clone, Rat, N-HA tag RG80714-NY
POLR2E cDNA ORF Clone, Rat, C-Myc tag RG80714-CM
POLR2E qPCR Primer Pairs, Rat RP300678

POLR2E cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
POLR2E cDNA ORF Clone in Cloning Vector, Mouse MG53189-G
POLR2E cDNA ORF Clone, Mouse, untagged MG53189-UT
POLR2E cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53189-ACG
POLR2E Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53189-ACGLN
POLR2E cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53189-ANG
POLR2E cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53189-ACR
POLR2E cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53189-ANR
POLR2E cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53189-CF
POLR2E cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53189-NF
POLR2E cDNA ORF Clone, Mouse, C-His tag MG53189-CH
POLR2E cDNA ORF Clone, Mouse, N-His tag MG53189-NH
POLR2E cDNA ORF Clone, Mouse, C-HA tag MG53189-CY
POLR2E cDNA ORF Clone, Mouse, N-HA tag MG53189-NY
POLR2E cDNA ORF Clone, Mouse, C-Myc tag MG53189-CM
POLR2E cDNA ORF Clone, Mouse, N-Myc tag MG53189-NM

POLR2E cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
POLR2E cDNA ORF Clone in Cloning Vector, Human HG18316-U
POLR2E Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18316-ACGLN
info info
添加购物车成功! 添加购物车失败!