PLEKHB2 cDNA ORF Clone, Rat, untagged

Cat: RG81012-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PLEKHB2 Reagents
CRO Services
Product recommended

All PLEKHB2 Reagents
PLEKHB2 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
666 bp
Description
Full length Clone DNA of Rat pleckstrin homology domain containing, family B (evectins) member 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PLEKHB2 Background Information
Full Name
pleckstrin homology domain containing B2

PLEKHB2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PLEKHB2 cDNA ORF Clone in Cloning Vector, Rat RG81012-U
PLEKHB2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81012-ACGLN
PLEKHB2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81012-ACG
PLEKHB2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81012-ANG
PLEKHB2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81012-ACR
PLEKHB2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81012-ANR
PLEKHB2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81012-CF
PLEKHB2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81012-NF
PLEKHB2 cDNA ORF Clone, Rat, C-His tag RG81012-CH
PLEKHB2 cDNA ORF Clone, Rat, N-His tag RG81012-NH
PLEKHB2 cDNA ORF Clone, Rat, C-HA tag RG81012-CY
PLEKHB2 cDNA ORF Clone, Rat, N-HA tag RG81012-NY
PLEKHB2 cDNA ORF Clone, Rat, C-Myc tag RG81012-CM
PLEKHB2 cDNA ORF Clone, Rat, N-Myc tag RG81012-NM
PLEKHB2 qPCR Primer Pairs, Rat RP300976

PLEKHB2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PLEKHB2 cDNA ORF Clone in Cloning Vector, Human HG23322-U
PLEKHB2 cDNA ORF Clone, Human, untagged HG23322-UT
PLEKHB2 cDNA ORF Clone, Human, C-GFPSpark® tag HG23322-ACG
PLEKHB2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23322-ACGLN
PLEKHB2 cDNA ORF Clone, Human, N-GFPSpark® tag HG23322-ANG
PLEKHB2 cDNA ORF Clone, Human, C-OFPSpark® tag HG23322-ACR
PLEKHB2 cDNA ORF Clone, Human, N-OFPSpark® tag HG23322-ANR
PLEKHB2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23322-CF
PLEKHB2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23322-NF
PLEKHB2 cDNA ORF Clone, Human, C-His tag HG23322-CH
PLEKHB2 cDNA ORF Clone, Human, N-His tag HG23322-NH
PLEKHB2 cDNA ORF Clone, Human, C-HA tag HG23322-CY
PLEKHB2 cDNA ORF Clone, Human, N-HA tag HG23322-NY
PLEKHB2 cDNA ORF Clone, Human, C-Myc tag HG23322-CM
PLEKHB2 cDNA ORF Clone, Human, N-Myc tag HG23322-NM
info info
添加购物车成功! 添加购物车失败!