D4S234E cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81326-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All D4S234E Reagents

CRO Services

Product recommended


All D4S234E Reagents

D4S234E cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
558 bp
Description
Full length Clone DNA of Rat neuron specific gene family member 1 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

D4S234E Background Information

Full Name
neuron specific gene family member 1

D4S234E cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
D4S234E cDNA ORF Clone in Cloning Vector, Rat RG81326-G
D4S234E cDNA ORF Clone, Rat, untagged RG81326-UT
D4S234E Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81326-ACGLN
D4S234E cDNA ORF Clone, Rat, C-GFPSpark® tag RG81326-ACG
D4S234E cDNA ORF Clone, Rat, N-GFPSpark® tag RG81326-ANG
D4S234E cDNA ORF Clone, Rat, C-OFPSpark® tag RG81326-ACR
D4S234E cDNA ORF Clone, Rat, N-OFPSpark® tag RG81326-ANR
D4S234E cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81326-CF
D4S234E cDNA ORF Clone, Rat, C-His tag RG81326-CH
D4S234E cDNA ORF Clone, Rat, N-His tag RG81326-NH
D4S234E cDNA ORF Clone, Rat, C-HA tag RG81326-CY
D4S234E cDNA ORF Clone, Rat, N-HA tag RG81326-NY
D4S234E cDNA ORF Clone, Rat, C-Myc tag RG81326-CM
D4S234E cDNA ORF Clone, Rat, N-Myc tag RG81326-NM
D4S234E qPCR Primer Pairs, Rat RP301297

D4S234E cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
D4S234E cDNA ORF Clone in Cloning Vector, Mouse MG52311-G
D4S234E cDNA ORF Clone, Mouse, untagged MG52311-UT
D4S234E cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52311-ACG
D4S234E Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52311-ACGLN
D4S234E cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52311-ANG
D4S234E cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52311-ACR
D4S234E cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52311-ANR
D4S234E cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52311-CF
D4S234E cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52311-NF
D4S234E cDNA ORF Clone, Mouse, C-His tag MG52311-CH
D4S234E cDNA ORF Clone, Mouse, N-His tag MG52311-NH
D4S234E cDNA ORF Clone, Mouse, C-HA tag MG52311-CY
D4S234E cDNA ORF Clone, Mouse, N-HA tag MG52311-NY
D4S234E cDNA ORF Clone, Mouse, C-Myc tag MG52311-CM
D4S234E cDNA ORF Clone, Mouse, N-Myc tag MG52311-NM
D4S234E qPCR Primer Pairs, Mouse MP202184

D4S234E cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
D4S234E cDNA ORF Clone in Cloning Vector, Human HG14364-G
D4S234E cDNA ORF Clone, Human, untagged HG23204-UT
D4S234E cDNA ORF Clone, Human, untagged HG14364-UT
D4S234E Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14364-ACGLN
D4S234E cDNA ORF Clone, Human, C-GFPSpark® tag HG14364-ACG
D4S234E cDNA ORF Clone, Human, C-OFPSpark® tag HG14364-ACR
D4S234E cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14364-CF
D4S234E cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14364-NF
D4S234E cDNA ORF Clone, Human, C-His tag HG14364-CH
D4S234E cDNA ORF Clone, Human, N-His tag HG14364-NH
D4S234E cDNA ORF Clone, Human, C-HA tag HG14364-CY
D4S234E cDNA ORF Clone, Human, N-HA tag HG14364-NY
D4S234E cDNA ORF Clone, Human, C-Myc tag HG14364-CM
D4S234E cDNA ORF Clone, Human, N-Myc tag HG14364-NM
D4S234E qPCR Primer Pairs, Human HP103013
info info
添加购物车成功! 添加购物车失败!