MINOS1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81337-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MINOS1 Reagents
CRO Services
Product recommended

All MINOS1 Reagents
MINOS1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
231 bp
Description
Full length Clone DNA of Rat mitochondrial inner membrane organizing system 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MINOS1 Background Information
Full Name
mitochondrial inner membrane organizing system 1

MINOS1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MINOS1 cDNA ORF Clone in Cloning Vector, Rat RG81337-G
MINOS1 cDNA ORF Clone, Rat, untagged RG81337-UT
MINOS1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81337-ACG
MINOS1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81337-ACGLN
MINOS1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81337-ANG
MINOS1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81337-ACR
MINOS1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81337-ANR
MINOS1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81337-CF
MINOS1 cDNA ORF Clone, Rat, C-His tag RG81337-CH
MINOS1 cDNA ORF Clone, Rat, N-His tag RG81337-NH
MINOS1 cDNA ORF Clone, Rat, C-HA tag RG81337-CY
MINOS1 cDNA ORF Clone, Rat, N-HA tag RG81337-NY
MINOS1 cDNA ORF Clone, Rat, C-Myc tag RG81337-CM
MINOS1 cDNA ORF Clone, Rat, N-Myc tag RG81337-NM
MINOS1 qPCR Primer Pairs, Rat RP301283

MINOS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MINOS1 cDNA ORF Clone in Cloning Vector, Human HG26280-U
MINOS1 cDNA ORF Clone, Human, untagged HG26280-UT
MINOS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG26280-ACG
MINOS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG26280-ACGLN
MINOS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG26280-ANG
MINOS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG26280-ACR
MINOS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG26280-ANR
MINOS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG26280-CF
MINOS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG26280-NF
MINOS1 cDNA ORF Clone, Human, C-His tag HG26280-CH
MINOS1 cDNA ORF Clone, Human, N-His tag HG26280-NH
MINOS1 cDNA ORF Clone, Human, C-HA tag HG26280-CY
MINOS1 cDNA ORF Clone, Human, N-HA tag HG26280-NY
MINOS1 cDNA ORF Clone, Human, C-Myc tag HG26280-CM
MINOS1 cDNA ORF Clone, Human, N-Myc tag HG26280-NM
info info
添加购物车成功! 添加购物车失败!