LIPA cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81145-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LIPA Reagents
CRO Services
Product recommended

All LIPA Reagents
LIPA cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1194 bp
Description
Full length Clone DNA of Rat lipase A, lysosomal acid, cholesterol esterase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LIPA Background Information
Full Name
lipase A, lysosomal acid, cholesterol esterase

LIPA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LIPA cDNA ORF Clone in Cloning Vector, Rat RG81145-U
LIPA cDNA ORF Clone, Rat, untagged RG81145-UT
LIPA cDNA ORF Clone, Rat, C-GFPSpark® tag RG81145-ACG
LIPA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81145-ACGLN
LIPA cDNA ORF Clone, Rat, C-OFPSpark® tag RG81145-ACR
LIPA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81145-NF
LIPA cDNA ORF Clone, Rat, C-His tag RG81145-CH
LIPA cDNA ORF Clone, Rat, N-His tag RG81145-NH
LIPA cDNA ORF Clone, Rat, C-HA tag RG81145-CY
LIPA cDNA ORF Clone, Rat, N-HA tag RG81145-NY
LIPA cDNA ORF Clone, Rat, C-Myc tag RG81145-CM
LIPA cDNA ORF Clone, Rat, N-Myc tag RG81145-NM
LIPA qPCR Primer Pairs, Rat RP301101

LIPA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LIPA cDNA ORF Clone in Cloning Vector, Mouse MG59034-U
LIPA cDNA ORF Clone, Mouse, untagged MG59034-UT
LIPA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59034-ACGLN
LIPA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59034-ACG
LIPA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59034-ACR
LIPA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59034-CF
LIPA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59034-NF
LIPA cDNA ORF Clone, Mouse, C-His tag MG59034-CH
LIPA cDNA ORF Clone, Mouse, N-His tag MG59034-NH
LIPA cDNA ORF Clone, Mouse, C-HA tag MG59034-CY
LIPA cDNA ORF Clone, Mouse, N-HA tag MG59034-NY
LIPA cDNA ORF Clone, Mouse, C-Myc tag MG59034-CM
LIPA cDNA ORF Clone, Mouse, N-Myc tag MG59034-NM

LIPA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LIPA cDNA ORF Clone in Cloning Vector, Human HG16677-U
LIPA cDNA ORF Clone, Human, untagged HG16677-UT
LIPA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16677-ACGLN
LIPA cDNA ORF Clone, Human, C-GFPSpark® tag HG16677-ACG
LIPA cDNA ORF Clone, Human, C-OFPSpark® tag HG16677-ACR
LIPA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16677-CF
LIPA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16677-NF
LIPA cDNA ORF Clone, Human, C-His tag HG16677-CH
LIPA cDNA ORF Clone, Human, N-His tag HG16677-NH
LIPA cDNA ORF Clone, Human, C-HA tag HG16677-CY
LIPA cDNA ORF Clone, Human, N-HA tag HG16677-NY
LIPA cDNA ORF Clone, Human, C-Myc tag HG16677-CM
LIPA cDNA ORF Clone, Human, N-Myc tag HG16677-NM
info info
添加购物车成功! 添加购物车失败!