Integrin beta 3 cDNA ORF Clone, Rat, C-His tag

Cat: RG80312-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Integrin beta 3 Reagents
CRO Services
Product recommended

All Integrin beta 3 Reagents
Integrin beta 3 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2409 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat integrin, beta 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI(two restriction sites) + XbaI(6kb+1.94kb+0.48)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Integrin beta 3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Integrin beta 3 cDNA ORF Clone, Rat, C-His tag Validated Images
Rat CD61/Integrin beta 3/ITGB3 Gene Plasmid Map 17379
Integrin beta 3 Background Information
Full Name
integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)

Integrin beta 3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Integrin beta 3 cDNA ORF Clone in Cloning Vector, Rhesus CG90309-G
Integrin beta 3 cDNA ORF Clone, Rhesus, untagged CG90309-UT
Integrin beta 3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90309-ACG
Integrin beta 3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90309-ACGLN
Integrin beta 3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90309-ACR
Integrin beta 3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90309-CF
Integrin beta 3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90309-NF
Integrin beta 3 cDNA ORF Clone, Rhesus, C-His tag CG90309-CH
Integrin beta 3 cDNA ORF Clone, Rhesus, N-His tag CG90309-NH
Integrin beta 3 cDNA ORF Clone, Rhesus, C-HA tag CG90309-CY
Integrin beta 3 cDNA ORF Clone, Rhesus, N-HA tag CG90309-NY
Integrin beta 3 cDNA ORF Clone, Rhesus, C-Myc tag CG90309-CM
Integrin beta 3 cDNA ORF Clone, Rhesus, N-Myc tag CG90309-NM

Integrin beta 3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Integrin beta 3 cDNA ORF Clone in Cloning Vector, Rat RG80312-G
Integrin beta 3 cDNA ORF Clone, Rat, untagged RG80312-UT
Integrin beta 3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80312-ACGLN
Integrin beta 3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80312-ACG
Integrin beta 3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80312-ACR
Integrin beta 3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80312-CF
Integrin beta 3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80312-NF
Integrin beta 3 cDNA ORF Clone, Rat, N-His tag RG80312-NH
Integrin beta 3 cDNA ORF Clone, Rat, C-HA tag RG80312-CY
Integrin beta 3 cDNA ORF Clone, Rat, N-HA tag RG80312-NY
Integrin beta 3 cDNA ORF Clone, Rat, C-Myc tag RG80312-CM
Integrin beta 3 cDNA ORF Clone, Rat, N-Myc tag RG80312-NM
Integrin beta 3 qPCR Primer Pairs, Rat RP300285

Integrin beta 3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Integrin beta 3 cDNA ORF Clone in Cloning Vector, Mouse MG50080-M
Integrin beta 3 cDNA ORF Clone, Mouse, untagged MG50080-UT
Integrin beta 3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50080-ACGLN
Integrin beta 3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50080-ACG
Integrin beta 3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50080-ACR
Integrin beta 3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50080-CF
Integrin beta 3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50080-NF
Integrin beta 3 cDNA ORF Clone, Mouse, C-His tag MG50080-CH
Integrin beta 3 cDNA ORF Clone, Mouse, N-His tag MG50080-NH
Integrin beta 3 cDNA ORF Clone, Mouse, C-HA tag MG50080-CY
Integrin beta 3 cDNA ORF Clone, Mouse, N-HA tag MG50080-NY
Integrin beta 3 cDNA ORF Clone, Mouse, C-Myc tag MG50080-CM
Integrin beta 3 cDNA ORF Clone, Mouse, N-Myc tag MG50080-NM
Integrin beta 3 qPCR Primer Pairs, Mouse MP200111

Integrin beta 3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Integrin beta 3 cDNA ORF Clone in Cloning Vector, Human HG10787-M
Integrin beta 3 cDNA ORF Clone, Human, untagged HG10787-UT
Integrin beta 3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10787-ACGLN
Integrin beta 3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10787-ACG
Integrin beta 3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10787-ACR
Integrin beta 3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10787-CF
Integrin beta 3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10787-NF
Integrin beta 3 cDNA ORF Clone, Human, C-His tag HG10787-CH
Integrin beta 3 cDNA ORF Clone, Human, N-His tag HG10787-NH
Integrin beta 3 cDNA ORF Clone, Human, C-HA tag HG10787-CY
Integrin beta 3 cDNA ORF Clone, Human, N-HA tag HG10787-NY
Integrin beta 3 cDNA ORF Clone, Human, C-Myc tag HG10787-CM
Integrin beta 3 cDNA ORF Clone, Human, N-Myc tag HG10787-NM
Integrin beta 3 qPCR Primer Pairs, Human HP100908
info info
添加购物车成功! 添加购物车失败!