IFN-beta cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80172-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IFN-beta Reagents
CRO Services
Product recommended

All IFN-beta Reagents
IFN-beta cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
555 bp
Description
Full length Clone DNA of Rat interferon beta 1, fibroblast with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IFN-beta Background Information

Interferons (IFNs) are natural glycoproteins belonging to the cytokine superfamily, and are produced by the cells of the immune system of most vertebrates in response to challenges by foreign agents such as viruses, parasites and tumor cells. Interferon-beta (IFN beta) is an extra-cellular protein mediator of host defense and homeostasis. IFN beta has well-established direct antiviral, antiproliferative and immunomodulatory properties. Recombinant IFN beta is approved for the treatment of relapsing-remitting multiple sclerosis. The recombinant IFN beta protein has the theoretical potential to either treat or cause autoimmune neuromuscular disorders by altering the complicated and delicate balances within the immune system networks. It is the most widely prescribed disease-modifying therapy for multiple sclerosis (MS). Large-scale clinical trials have established the clinical efficacy of IFN beta in reducing relapses and slowing disease progression in relapsing-remitting MS. IFN beta therapy was shown to be comparably beneficial for opticospinal MS (OSMS) and conventional MS in Japanese. IFN beta is effective in reducing relapses in secondary progressive MS and may have a modest effect in slowing disability progression. In addition to the common antiviral activity, IFN beta also induces increased production of the p53 gene product which promotes apoptosis, and thus has therapeutic effect against certain cancers. The role of IFN-beta in bone metabolism could warrant its systematic evaluation as a potential adjunct to therapeutic regimens of osteolytic diseases. Furthermore, IFN beta might play a beneficial role in the development of a chronic progressive CNS inflammation.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interferon, beta 1, fibroblast
References
  • Kohriyama T, et al. (2008) Interferon-beta treatment for multiple sclerosis and predictors of response. Nippon Rinsho. 66(6): 1119-26.
  • Stbgen JP. (2009) Recombinant interferon-beta therapy and neuromuscular disorders. J Neuroimmunol. 212(1-2): 132-41.
  • Abraham AK, et al. (2009) Mechanisms of interferon-beta effects on bone homeostasis. Biochem Pharmacol. 77(12): 1757-62.
  • IFN-beta cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IFN-beta cDNA ORF Clone in Cloning Vector, Rhesus CG90104-G
    IFN-beta cDNA ORF Clone, Rhesus, untagged CG90104-UT
    IFN-beta cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90104-ACG
    IFN-beta Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90104-ACGLN
    IFN-beta cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90104-ACR
    IFN-beta cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90104-CF
    IFN-beta cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90104-NF
    IFN-beta cDNA ORF Clone, Rhesus, C-His tag CG90104-CH
    IFN-beta cDNA ORF Clone, Rhesus, N-His tag CG90104-NH
    IFN-beta cDNA ORF Clone, Rhesus, C-HA tag CG90104-CY
    IFN-beta cDNA ORF Clone, Rhesus, N-HA tag CG90104-NY
    IFN-beta cDNA ORF Clone, Rhesus, C-Myc tag CG90104-CM
    IFN-beta cDNA ORF Clone, Rhesus, N-Myc tag CG90104-NM

    IFN-beta cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IFN-beta cDNA ORF Clone in Cloning Vector, Rat RG80172-G
    IFN-beta cDNA ORF Clone, Rat, untagged RG80172-UT
    IFN-beta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80172-ACGLN
    IFN-beta cDNA ORF Clone, Rat, C-GFPSpark® tag RG80172-ACG
    IFN-beta cDNA ORF Clone, Rat, C-OFPSpark® tag RG80172-ACR
    IFN-beta cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80172-CF
    IFN-beta cDNA ORF Clone, Rat, C-His tag RG80172-CH
    IFN-beta cDNA ORF Clone, Rat, N-His tag RG80172-NH
    IFN-beta cDNA ORF Clone, Rat, C-HA tag RG80172-CY
    IFN-beta cDNA ORF Clone, Rat, N-HA tag RG80172-NY
    IFN-beta cDNA ORF Clone, Rat, C-Myc tag RG80172-CM
    IFN-beta cDNA ORF Clone, Rat, N-Myc tag RG80172-NM
    IFN-beta qPCR Primer Pairs, Rat RP300165

    IFN-beta cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IFN-beta cDNA ORF Clone in Cloning Vector, Mouse MG50708-M
    IFN-beta cDNA ORF Clone, Mouse, untagged MG50708-UT
    IFN-beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50708-ACG
    IFN-beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50708-ACGLN
    IFN-beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50708-ACR
    IFN-beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50708-CF
    IFN-beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50708-NF
    IFN-beta cDNA ORF Clone, Mouse, C-His tag MG50708-CH
    IFN-beta cDNA ORF Clone, Mouse, N-His tag MG50708-NH
    IFN-beta cDNA ORF Clone, Mouse, C-HA tag MG50708-CY
    IFN-beta cDNA ORF Clone, Mouse, N-HA tag MG50708-NY
    IFN-beta cDNA ORF Clone, Mouse, C-Myc tag MG50708-CM
    IFN-beta cDNA ORF Clone, Mouse, N-Myc tag MG50708-NM
    IFN-beta qPCR Primer Pairs, Mouse MP200683

    IFN-beta cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IFN-beta cDNA ORF Clone in Cloning Vector, Human HG10704-G
    IFN-beta cDNA ORF Clone, Human, untagged HG10704-UT
    IFN-beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10704-ACGLN
    IFN-beta cDNA ORF Clone, Human, C-GFPSpark® tag HG10704-ACG
    IFN-beta cDNA ORF Clone, Human, C-OFPSpark® tag HG10704-ACR
    IFN-beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10704-CF
    IFN-beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10704-NF
    IFN-beta cDNA ORF Clone, Human, C-His tag HG10704-CH
    IFN-beta cDNA ORF Clone, Human, N-His tag HG10704-NH
    IFN-beta cDNA ORF Clone, Human, C-HA tag HG10704-CY
    IFN-beta cDNA ORF Clone, Human, N-HA tag HG10704-NY
    IFN-beta cDNA ORF Clone, Human, C-Myc tag HG10704-CM
    IFN-beta cDNA ORF Clone, Human, N-Myc tag HG10704-NM
    IFN-beta qPCR Primer Pairs, Human HP100883
    info info
    添加购物车成功! 添加购物车失败!