Interferon alpha 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80174-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Interferon alpha 1 Reagents
CRO Services
Product recommended

All Interferon alpha 1 Reagents
Interferon alpha 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
579 bp
Description
Full length Clone DNA of Rat interferon-alpha 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Interferon alpha 1 Background Information

IFNA1, also known as IFN-alpha and IFNA, belongs to the alpha/beta interferon family. Interferons(IFNs) are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumor cells. They belong to the large class of glycoproteins known as cytokines. IFNs stimulate the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs can activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they also increase the ability of uninfected host cells to resist new infection by virus.Leukocyte interferon is produced predominantly by B lymphocytes. Immune interferon is produced by mitogen- or antigen-stimulated T lymphocytes. IFNA1 is produced by macrophages and has antiviral activities.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interferon, alpha 1
References
  • Takayama I, et al. (2012) The nucleocapsid protein of measles virus blocks host interferon response. Virology. 424(1):45-55.
  • Vairo D, et al. (2011) Severe impairment of IFN-? and IFN-? responses in cells of a patient with a novel STAT1 splicing mutation. Blood. 118(7):1806-17.
  • Bhattacharya S, et al. (2011) Bcr-abl signals to desensitize chronic myeloid leukemia cells to IFN? via accelerating the degradation of its receptor. Blood. 118(15):4179-87.
  • Interferon alpha 1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Interferon alpha 1 cDNA ORF Clone in Cloning Vector, Rat RG80174-G
    Interferon alpha 1 cDNA ORF Clone, Rat, untagged RG80174-UT
    Interferon alpha 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80174-ACGLN
    Interferon alpha 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80174-ACG
    Interferon alpha 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80174-ACR
    Interferon alpha 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80174-CF
    Interferon alpha 1 cDNA ORF Clone, Rat, C-His tag RG80174-CH
    Interferon alpha 1 cDNA ORF Clone, Rat, N-His tag RG80174-NH
    Interferon alpha 1 cDNA ORF Clone, Rat, C-HA tag RG80174-CY
    Interferon alpha 1 cDNA ORF Clone, Rat, N-HA tag RG80174-NY
    Interferon alpha 1 cDNA ORF Clone, Rat, C-Myc tag RG80174-CM
    Interferon alpha 1 cDNA ORF Clone, Rat, N-Myc tag RG80174-NM
    Interferon alpha 1 qPCR Primer Pairs, Rat RP300167

    Interferon alpha 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Interferon alpha 1 cDNA ORF Clone in Cloning Vector, Human HG12341-G
    Interferon alpha 1 cDNA ORF Clone, Human, untagged HG12341-UT
    Interferon alpha 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12341-ACG
    Interferon alpha 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12341-ACGLN
    Interferon alpha 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12341-ACR
    Interferon alpha 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12341-CF
    Interferon alpha 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12341-NF
    Interferon alpha 1 cDNA ORF Clone, Human, C-His tag HG12341-CH
    Interferon alpha 1 cDNA ORF Clone, Human, N-His tag HG12341-NH
    Interferon alpha 1 cDNA ORF Clone, Human, C-HA tag HG12341-CY
    Interferon alpha 1 cDNA ORF Clone, Human, N-HA tag HG12341-NY
    Interferon alpha 1 cDNA ORF Clone, Human, C-Myc tag HG12341-CM
    Interferon alpha 1 cDNA ORF Clone, Human, N-Myc tag HG12341-NM
    Interferon alpha 1 qPCR Primer Pairs, Human HP104901

    Interferon alpha 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Interferon alpha 1 qPCR Primer Pairs, Mouse MP200516
    info info
    添加购物车成功! 添加购物车失败!