IFITM1 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80365-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IFITM1 Reagents
CRO Services
Product recommended

All IFITM1 Reagents
IFITM1 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
330 bp
Description
Full length Clone DNA of Rat interferon induced transmembrane protein 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IFITM1 Background Information
Full Name
interferon induced transmembrane protein 1

IFITM1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
IFITM1 cDNA ORF Clone in Cloning Vector, Rhesus CG90263-G
IFITM1 cDNA ORF Clone, Rhesus, untagged CG90263-UT
IFITM1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90263-ACG
IFITM1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90263-ACGLN
IFITM1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90263-ACR
IFITM1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90263-CF
IFITM1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90263-NF
IFITM1 cDNA ORF Clone, Rhesus, C-His tag CG90263-CH
IFITM1 cDNA ORF Clone, Rhesus, N-His tag CG90263-NH
IFITM1 cDNA ORF Clone, Rhesus, C-HA tag CG90263-CY
IFITM1 cDNA ORF Clone, Rhesus, N-HA tag CG90263-NY
IFITM1 cDNA ORF Clone, Rhesus, C-Myc tag CG90263-CM
IFITM1 cDNA ORF Clone, Rhesus, N-Myc tag CG90263-NM

IFITM1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IFITM1 cDNA ORF Clone in Cloning Vector, Rat RG80365-G
IFITM1 cDNA ORF Clone, Rat, untagged RG80365-UT
IFITM1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80365-ACGLN
IFITM1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80365-ACG
IFITM1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80365-ACR
IFITM1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80365-CF
IFITM1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80365-NF
IFITM1 cDNA ORF Clone, Rat, C-His tag RG80365-CH
IFITM1 cDNA ORF Clone, Rat, N-His tag RG80365-NH
IFITM1 cDNA ORF Clone, Rat, N-HA tag RG80365-NY
IFITM1 cDNA ORF Clone, Rat, C-Myc tag RG80365-CM
IFITM1 cDNA ORF Clone, Rat, N-Myc tag RG80365-NM
IFITM1 qPCR Primer Pairs, Rat RP300335

IFITM1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IFITM1 cDNA ORF Clone in Cloning Vector, Mouse MG50876-G
IFITM1 cDNA ORF Clone, Mouse, untagged MG50876-UT
IFITM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50876-ACGLN
IFITM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50876-ACG
IFITM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50876-ACR
IFITM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50876-CF
IFITM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50876-NF
IFITM1 cDNA ORF Clone, Mouse, C-His tag MG50876-CH
IFITM1 cDNA ORF Clone, Mouse, N-His tag MG50876-NH
IFITM1 cDNA ORF Clone, Mouse, C-HA tag MG50876-CY
IFITM1 cDNA ORF Clone, Mouse, C-HA tag MG50876-G-Y
IFITM1 cDNA ORF Clone, Mouse, N-HA tag MG50876-NY
IFITM1 cDNA ORF Clone, Mouse, C-Myc tag MG50876-CM
IFITM1 cDNA ORF Clone, Mouse, N-Myc tag MG50876-NM
IFITM1 qPCR Primer Pairs, Mouse MP200847

IFITM1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IFITM1 cDNA ORF Clone in Cloning Vector, Human HG12049-M
IFITM1 cDNA ORF Clone, Human, untagged HG12049-UT
IFITM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12049-ACG
IFITM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12049-ACGLN
IFITM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12049-ACR
IFITM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12049-CF
IFITM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12049-NF
IFITM1 cDNA ORF Clone, Human, C-His tag HG12049-CH
IFITM1 cDNA ORF Clone, Human, N-His tag HG12049-NH
IFITM1 cDNA ORF Clone, Human, C-HA tag HG12049-CY
IFITM1 cDNA ORF Clone, Human, N-HA tag HG12049-NY
IFITM1 cDNA ORF Clone, Human, C-Myc tag HG12049-CM
IFITM1 cDNA ORF Clone, Human, N-Myc tag HG12049-NM
IFITM1 qPCR Primer Pairs, Human HP101582
info info
添加购物车成功! 添加购物车失败!