IFI47 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81100-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All IFI47 Reagents

CRO Services

Product recommended


All IFI47 Reagents

IFI47 cDNA ORF Clone, Rat, C-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1263 bp
Description
Full length Clone DNA of Rat interferon gamma inducible protein 47 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IFI47 Background Information

Full Name
interferon gamma inducible protein 47

IFI47 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IFI47 cDNA ORF Clone in Cloning Vector, Rat RG81100-U
IFI47 cDNA ORF Clone, Rat, untagged RG81100-UT
IFI47 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81100-ACGLN
IFI47 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81100-ACG
IFI47 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81100-ANG
IFI47 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81100-ACR
IFI47 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81100-ANR
IFI47 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81100-CF
IFI47 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81100-NF
IFI47 cDNA ORF Clone, Rat, C-His tag RG81100-CH
IFI47 cDNA ORF Clone, Rat, N-His tag RG81100-NH
IFI47 cDNA ORF Clone, Rat, C-HA tag RG81100-CY
IFI47 cDNA ORF Clone, Rat, N-HA tag RG81100-NY
IFI47 cDNA ORF Clone, Rat, N-Myc tag RG81100-NM
IFI47 qPCR Primer Pairs, Rat RP301057

IFI47 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IFI47 cDNA ORF Clone in Cloning Vector, Mouse MG53052-G
IFI47 cDNA ORF Clone, Mouse, untagged MG53052-UT
IFI47 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53052-ACG
IFI47 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53052-ACGLN
IFI47 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53052-ACR
IFI47 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53052-CF
IFI47 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53052-NF
IFI47 cDNA ORF Clone, Mouse, C-His tag MG53052-CH
IFI47 cDNA ORF Clone, Mouse, N-His tag MG53052-NH
IFI47 cDNA ORF Clone, Mouse, C-HA tag MG53052-CY
IFI47 cDNA ORF Clone, Mouse, N-HA tag MG53052-NY
IFI47 cDNA ORF Clone, Mouse, C-Myc tag MG53052-CM
IFI47 cDNA ORF Clone, Mouse, N-Myc tag MG53052-NM
info info
添加购物车成功! 添加购物车失败!