HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-HA tag

Cat: RG80499-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HBB/hemoglobin-beta Reagents
CRO Services
Product recommended

All HBB/hemoglobin-beta Reagents
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Rat hemoglobin, beta with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HBB/hemoglobin-beta Background Information
Full Name
hemoglobin, beta

HBB/hemoglobin-beta cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HBB/hemoglobin-beta cDNA ORF Clone in Cloning Vector, Rat RG80499-U
HBB/hemoglobin-beta cDNA ORF Clone, Rat, untagged RG80499-UT
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-GFPSpark® tag RG80499-ACG
HBB/hemoglobin-beta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80499-ACGLN
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-GFPSpark® tag RG80499-ANG
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-OFPSpark® tag RG80499-ACR
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-OFPSpark® tag RG80499-ANR
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80499-CF
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80499-NF
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-His tag RG80499-CH
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-His tag RG80499-NH
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-HA tag RG80499-CY
HBB/hemoglobin-beta cDNA ORF Clone, Rat, C-Myc tag RG80499-CM
HBB/hemoglobin-beta cDNA ORF Clone, Rat, N-Myc tag RG80499-NM
HBB/hemoglobin-beta qPCR Primer Pairs, Rat RP300463

HBB/hemoglobin-beta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HBB/hemoglobin-beta cDNA ORF Clone in Cloning Vector, Mouse MG51438-G
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, untagged MG51438-UT
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51438-ACG
HBB/hemoglobin-beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51438-ACGLN
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51438-ANG
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51438-ACR
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51438-ANR
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51438-CF
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51438-NF
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-His tag MG51438-CH
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-His tag MG51438-NH
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-HA tag MG51438-CY
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-HA tag MG51438-NY
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, C-Myc tag MG51438-CM
HBB/hemoglobin-beta cDNA ORF Clone, Mouse, N-Myc tag MG51438-NM
HBB/hemoglobin-beta qPCR Primer Pairs, Mouse MP201322

HBB/hemoglobin-beta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HBB/hemoglobin-beta cDNA ORF Clone in Cloning Vector, Human HG12016-G
HBB/hemoglobin-beta cDNA ORF Clone, Human, untagged HG12016-UT
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-GFPSpark® tag HG12016-ACG
HBB/hemoglobin-beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12016-ACGLN
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-GFPSpark® tag HG12016-ANG
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-OFPSpark® tag HG12016-ACR
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-OFPSpark® tag HG12016-ANR
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12016-CF
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12016-NF
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-His tag HG12016-CH
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-His tag HG12016-NH
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-HA tag HG12016-CY
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-HA tag HG12016-NY
HBB/hemoglobin-beta cDNA ORF Clone, Human, C-Myc tag HG12016-CM
HBB/hemoglobin-beta cDNA ORF Clone, Human, N-Myc tag HG12016-NM
HBB/hemoglobin-beta qPCR Primer Pairs, Human HP101552
info info
添加购物车成功! 添加购物车失败!