FKBP25 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80744-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FKBP25 Reagents
CRO Services
Product recommended

All FKBP25 Reagents
FKBP25 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Rat FK506 binding protein 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FKBP25 Background Information
Full Name
FK506 binding protein 3
References
  • Wiederrecht G., et al., 1992, Biochem. Biophys. Res. Commun. 185: 298 - 303.
  • Dephoure N., et al.,2008, Proc. Natl. Acad. Sci. USA.105:10762-7.
  • Gauci S., et al., 2009, Anal. Chem. 81:4493-4501.
  • Choudhary C., et al., 2009, Science. 325:834-840.
  • FKBP25 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    FKBP25 cDNA ORF Clone in Cloning Vector, Rat RG80744-U
    FKBP25 cDNA ORF Clone, Rat, untagged RG80744-UT
    FKBP25 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80744-ACGLN
    FKBP25 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80744-ACG
    FKBP25 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80744-ACR
    FKBP25 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80744-CF
    FKBP25 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80744-NF
    FKBP25 cDNA ORF Clone, Rat, C-His tag RG80744-CH
    FKBP25 cDNA ORF Clone, Rat, N-His tag RG80744-NH
    FKBP25 cDNA ORF Clone, Rat, C-HA tag RG80744-CY
    FKBP25 cDNA ORF Clone, Rat, N-HA tag RG80744-NY
    FKBP25 cDNA ORF Clone, Rat, C-Myc tag RG80744-CM
    FKBP25 qPCR Primer Pairs, Rat RP300708

    FKBP25 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FKBP25 cDNA ORF Clone in Cloning Vector, Mouse MG53194-G
    FKBP25 cDNA ORF Clone, Mouse, untagged MG53194-UT
    FKBP25 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53194-ACG
    FKBP25 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53194-ACGLN
    FKBP25 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53194-ANG
    FKBP25 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53194-ACR
    FKBP25 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53194-ANR
    FKBP25 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53194-CF
    FKBP25 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53194-NF
    FKBP25 cDNA ORF Clone, Mouse, C-His tag MG53194-CH
    FKBP25 cDNA ORF Clone, Mouse, N-His tag MG53194-NH
    FKBP25 cDNA ORF Clone, Mouse, C-HA tag MG53194-CY
    FKBP25 cDNA ORF Clone, Mouse, N-HA tag MG53194-NY
    FKBP25 cDNA ORF Clone, Mouse, C-Myc tag MG53194-CM
    FKBP25 cDNA ORF Clone, Mouse, N-Myc tag MG53194-NM

    FKBP25 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FKBP25 cDNA ORF Clone in Cloning Vector, Human HG12582-U
    FKBP25 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12582-ACGLN
    info info
    添加购物车成功! 添加购物车失败!