EIF3S4 cDNA ORF Clone, Rat, untagged

Cat: RG81021-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EIF3S4 Reagents
CRO Services
Product recommended

All EIF3S4 Reagents
EIF3S4 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
963 bp
Description
Full length Clone DNA of Rat eukaryotic translation initiation factor 3, subunit G.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF3S4 Background Information
Full Name
eukaryotic translation initiation factor 3, subunit G

EIF3S4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EIF3S4 cDNA ORF Clone in Cloning Vector, Rat RG81021-U
EIF3S4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81021-ACG
EIF3S4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81021-ACGLN
EIF3S4 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81021-ANG
EIF3S4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81021-ACR
EIF3S4 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81021-ANR
EIF3S4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81021-CF
EIF3S4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81021-NF
EIF3S4 cDNA ORF Clone, Rat, C-His tag RG81021-CH
EIF3S4 cDNA ORF Clone, Rat, N-His tag RG81021-NH
EIF3S4 cDNA ORF Clone, Rat, C-HA tag RG81021-CY
EIF3S4 cDNA ORF Clone, Rat, N-HA tag RG81021-NY
EIF3S4 cDNA ORF Clone, Rat, C-Myc tag RG81021-CM
EIF3S4 cDNA ORF Clone, Rat, N-Myc tag RG81021-NM
EIF3S4 qPCR Primer Pairs, Rat RP300985

EIF3S4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF3S4 cDNA ORF Clone in Cloning Vector, Mouse MG51651-G
EIF3S4 cDNA ORF Clone, Mouse, untagged MG51651-UT
EIF3S4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51651-ACGLN
EIF3S4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51651-ACG
EIF3S4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51651-ANG
EIF3S4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51651-ACR
EIF3S4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51651-ANR
EIF3S4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51651-CF
EIF3S4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51651-NF
EIF3S4 cDNA ORF Clone, Mouse, C-His tag MG51651-CH
EIF3S4 cDNA ORF Clone, Mouse, N-His tag MG51651-NH
EIF3S4 cDNA ORF Clone, Mouse, C-HA tag MG51651-CY
EIF3S4 cDNA ORF Clone, Mouse, N-HA tag MG51651-NY
EIF3S4 cDNA ORF Clone, Mouse, C-Myc tag MG51651-CM
EIF3S4 cDNA ORF Clone, Mouse, N-Myc tag MG51651-NM
EIF3S4 qPCR Primer Pairs, Mouse MP201524

EIF3S4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF3S4 cDNA ORF Clone in Cloning Vector, Human HG16964-U
EIF3S4 cDNA ORF Clone, Human, untagged HG16964-UT
EIF3S4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16964-ACG
EIF3S4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16964-ACGLN
EIF3S4 cDNA ORF Clone, Human, N-GFPSpark® tag HG16964-ANG
EIF3S4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16964-ACR
EIF3S4 cDNA ORF Clone, Human, N-OFPSpark® tag HG16964-ANR
EIF3S4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16964-CF
EIF3S4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16964-NF
EIF3S4 cDNA ORF Clone, Human, C-His tag HG16964-CH
EIF3S4 cDNA ORF Clone, Human, N-His tag HG16964-NH
EIF3S4 cDNA ORF Clone, Human, C-HA tag HG16964-CY
EIF3S4 cDNA ORF Clone, Human, N-HA tag HG16964-NY
EIF3S4 cDNA ORF Clone, Human, C-Myc tag HG16964-CM
EIF3S4 cDNA ORF Clone, Human, N-Myc tag HG16964-NM
info info
添加购物车成功! 添加购物车失败!