CXCL17 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80153-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CXCL17 Reagents
CRO Services
Product recommended

All CXCL17 Reagents
CXCL17 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
360 bp
Description
Full length Clone DNA of Rat chemokine (C-X-C motif) ligand 17 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCL17 Background Information
Full Name
chemokine (C-X-C motif) ligand 17

CXCL17 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
CXCL17 cDNA ORF Clone in Cloning Vector, Canine DG70065-G
CXCL17 cDNA ORF Clone, Canine, untagged DG70065-UT
CXCL17 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70065-ACGLN
CXCL17 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70065-ACG
CXCL17 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70065-ACR
CXCL17 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70065-CF
CXCL17 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70065-NF
CXCL17 cDNA ORF Clone, Canine, C-His tag DG70065-CH
CXCL17 cDNA ORF Clone, Canine, N-His tag DG70065-NH
CXCL17 cDNA ORF Clone, Canine, C-HA tag DG70065-CY
CXCL17 cDNA ORF Clone, Canine, N-HA tag DG70065-NY
CXCL17 cDNA ORF Clone, Canine, C-Myc tag DG70065-CM
CXCL17 cDNA ORF Clone, Canine, N-Myc tag DG70065-NM

CXCL17 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CXCL17 cDNA ORF Clone in Cloning Vector, Rat RG80153-G
CXCL17 cDNA ORF Clone, Rat, untagged RG80153-UT
CXCL17 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80153-ACGLN
CXCL17 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80153-ACG
CXCL17 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80153-ACR
CXCL17 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80153-CF
CXCL17 cDNA ORF Clone, Rat, C-His tag RG80153-CH
CXCL17 cDNA ORF Clone, Rat, N-His tag RG80153-NH
CXCL17 cDNA ORF Clone, Rat, C-HA tag RG80153-CY
CXCL17 cDNA ORF Clone, Rat, N-HA tag RG80153-NY
CXCL17 cDNA ORF Clone, Rat, C-Myc tag RG80153-CM
CXCL17 cDNA ORF Clone, Rat, N-Myc tag RG80153-NM
CXCL17 qPCR Primer Pairs, Rat RP300148

CXCL17 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CXCL17 cDNA ORF Clone in Cloning Vector, Mouse MG50143-M
CXCL17 cDNA ORF Clone, Mouse, untagged MG50143-UT
CXCL17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50143-ACG
CXCL17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50143-ACGLN
CXCL17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50143-ACR
CXCL17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50143-CF
CXCL17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50143-NF
CXCL17 cDNA ORF Clone, Mouse, C-His tag MG50143-CH
CXCL17 cDNA ORF Clone, Mouse, N-His tag MG50143-NH
CXCL17 cDNA ORF Clone, Mouse, C-HA tag MG50143-CY
CXCL17 cDNA ORF Clone, Mouse, N-HA tag MG50143-NY
CXCL17 cDNA ORF Clone, Mouse, C-Myc tag MG50143-CM
CXCL17 cDNA ORF Clone, Mouse, N-Myc tag MG50143-NM
CXCL17 qPCR Primer Pairs, Mouse MP200173

CXCL17 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CXCL17 cDNA ORF Clone in Cloning Vector, Human HG10879-M
CXCL17 cDNA ORF Clone, Human, untagged HG10879-UT
CXCL17 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10879-ACGLN
CXCL17 cDNA ORF Clone, Human, C-GFPSpark® tag HG10879-ACG
CXCL17 cDNA ORF Clone, Human, C-OFPSpark® tag HG10879-ACR
CXCL17 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10879-CF
CXCL17 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10879-NF
CXCL17 cDNA ORF Clone, Human, C-His tag HG10879-CH
CXCL17 cDNA ORF Clone, Human, N-His tag HG10879-NH
CXCL17 cDNA ORF Clone, Human, C-HA tag HG10879-CY
CXCL17 cDNA ORF Clone, Human, N-HA tag HG10879-NY
CXCL17 cDNA ORF Clone, Human, C-Myc tag HG10879-CM
CXCL17 cDNA ORF Clone, Human, N-Myc tag HG10879-NM
CXCL17 qPCR Primer Pairs, Human HP100765
info info
添加购物车成功! 添加购物车失败!