CRISP2 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80444-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CRISP2 Reagents

CRO Services

Product recommended


All CRISP2 Reagents

CRISP2 cDNA ORF Clone, Rat, N-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
732 bp
Description
Full length Clone DNA of Rat cysteine-rich secretory protein 2 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRISP2 Background Information

Full Name
cysteine-rich secretory protein 2

CRISP2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CRISP2 cDNA ORF Clone in Cloning Vector, Rat RG80444-G
CRISP2 cDNA ORF Clone, Rat, untagged RG80444-UT
CRISP2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80444-ACGLN
CRISP2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80444-ACG
CRISP2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80444-ACR
CRISP2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80444-CF
CRISP2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80444-NF
CRISP2 cDNA ORF Clone, Rat, C-His tag RG80444-CH
CRISP2 cDNA ORF Clone, Rat, N-His tag RG80444-NH
CRISP2 cDNA ORF Clone, Rat, C-HA tag RG80444-CY
CRISP2 cDNA ORF Clone, Rat, C-Myc tag RG80444-CM
CRISP2 cDNA ORF Clone, Rat, N-Myc tag RG80444-NM
CRISP2 qPCR Primer Pairs, Rat RP300413

CRISP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CRISP2 cDNA ORF Clone, Mouse, untagged MG59469-UT
CRISP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59469-ACGLN
CRISP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59469-ACG
CRISP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59469-ACR
CRISP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59469-CF
CRISP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59469-NF
CRISP2 cDNA ORF Clone, Mouse, C-His tag MG59469-CH
CRISP2 cDNA ORF Clone, Mouse, N-His tag MG59469-NH
CRISP2 cDNA ORF Clone, Mouse, C-HA tag MG59469-CY
CRISP2 cDNA ORF Clone, Mouse, N-HA tag MG59469-NY
CRISP2 cDNA ORF Clone, Mouse, C-Myc tag MG59469-CM
CRISP2 cDNA ORF Clone, Mouse, N-Myc tag MG59469-NM

CRISP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CRISP2 cDNA ORF Clone, Human, untagged HG21490-UT
info info
添加购物车成功! 添加购物车失败!