CNIH cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81125-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CNIH Reagents
CRO Services
Product recommended

All CNIH Reagents
CNIH cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
435 bp
Description
Full length Clone DNA of Rat cornichon family AMPA receptor auxiliary protein 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CNIH Background Information
Full Name
cornichon family AMPA receptor auxiliary protein 1

CNIH cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CNIH cDNA ORF Clone in Cloning Vector, Rat RG81125-U
CNIH cDNA ORF Clone, Rat, untagged RG81125-UT
CNIH Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81125-ACGLN
CNIH cDNA ORF Clone, Rat, C-GFPSpark® tag RG81125-ACG
CNIH cDNA ORF Clone, Rat, C-OFPSpark® tag RG81125-ACR
CNIH cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81125-NF
CNIH cDNA ORF Clone, Rat, C-His tag RG81125-CH
CNIH cDNA ORF Clone, Rat, N-His tag RG81125-NH
CNIH cDNA ORF Clone, Rat, C-HA tag RG81125-CY
CNIH cDNA ORF Clone, Rat, N-HA tag RG81125-NY
CNIH cDNA ORF Clone, Rat, C-Myc tag RG81125-CM
CNIH cDNA ORF Clone, Rat, N-Myc tag RG81125-NM
CNIH qPCR Primer Pairs, Rat RP301082

CNIH cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CNIH cDNA ORF Clone in Cloning Vector, Mouse MG53931-U
CNIH cDNA ORF Clone, Mouse, untagged MG53931-UT
CNIH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53931-ACG
CNIH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53931-ACGLN
CNIH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53931-ACR
CNIH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53931-CF
CNIH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53931-NF
CNIH cDNA ORF Clone, Mouse, C-His tag MG53931-CH
CNIH cDNA ORF Clone, Mouse, N-His tag MG53931-NH
CNIH cDNA ORF Clone, Mouse, C-HA tag MG53931-CY
CNIH cDNA ORF Clone, Mouse, N-HA tag MG53931-NY
CNIH cDNA ORF Clone, Mouse, C-Myc tag MG53931-CM
CNIH cDNA ORF Clone, Mouse, N-Myc tag MG53931-NM

CNIH cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CNIH cDNA ORF Clone in Cloning Vector, Human HG16518-G
CNIH cDNA ORF Clone, Human, untagged HG16518-UT
CNIH cDNA ORF Clone, Human, C-GFPSpark® tag HG16518-ACG
CNIH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16518-ACGLN
CNIH cDNA ORF Clone, Human, C-OFPSpark® tag HG16518-ACR
CNIH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16518-CF
CNIH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16518-NF
CNIH cDNA ORF Clone, Human, C-His tag HG16518-CH
CNIH cDNA ORF Clone, Human, N-His tag HG16518-NH
CNIH cDNA ORF Clone, Human, C-HA tag HG16518-CY
CNIH cDNA ORF Clone, Human, N-HA tag HG16518-NY
CNIH cDNA ORF Clone, Human, C-Myc tag HG16518-CM
CNIH cDNA ORF Clone, Human, N-Myc tag HG16518-NM
info info
添加购物车成功! 添加购物车失败!