Factor H cDNA ORF Clone, Rat, untagged

Cat: RG81017-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Factor H Reagents
CRO Services
Product recommended

All Factor H Reagents
Factor H cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1182 bp
Description
Full length Clone DNA of Rat complement factor H.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Factor H Background Information

Complement factor H, also known as H factor 1, and CFH, is a sialic acid containing glycoprotein that plays an integral role in the regulation of the complement-mediated immune system that is involved in microbial defense, immune complex processing, and programmed cell death. Factor H protects host cells from injury resulting from unrestrained complement activation. CFH regulates complement activation on self cells by possessing both cofactor activity for the Factor I mediated C3b cleavage, and decay accelerating activity against the alternative pathway C3 convertase, C3bBb. CFH protects self cells from complement activation but not bacteria/viruses. Due to the central role that CFH plays in the regulation of complement, there are many clinical implications arrising from aberrant CFH activity. Mutations in the Factor H gene are associated with severe and diverse diseases including the rare renal disorders hemolytic uremic syndrome (HUS) and membranoproliferative glomerulonephritis (MPGN) also termed dense deposit disease (DDD), membranoproliferative glomuleronephritis type II or dense deposit disease, as well as the more frequent retinal disease age related macular degeneration (AMD). In addition to its complement regulatory activities, factor H has multiple physiological activities and 1) acts as an extracellular matrix component, 2) binds to cellular receptors of the integrin type, and 3) interacts with a wide selection of ligands, such as the C-reactive protein, thrombospondin, bone sialoprotein, osteopontin, and heparin.

Full Name
complement factor H
References
  • Zipfel PF. (2001) Complement factor H: physiology and pathophysiology. Semin Thromb Hemost. 27(3): 191-9.
  • Zipfel PF, et al. (2008) The complement fitness factor H: role in human diseases and for immune escape of pathogens, like pneumococci. Vaccine. 26 Suppl 8: I67-74.
  • Ferreira VP, et al. (2010) Complement control protein factor H: the good, the bad, and the inadequate. Mol Immunol. 47(13): 2187-97.
  • Donoso LA, et al. (2010) The role of complement Factor H in age-related macular degeneration: a review. Surv Ophthalmol. 55(3): 227-46.
  • Factor H cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Factor H cDNA ORF Clone in Cloning Vector, Rat RG81017-U
    Factor H Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81017-ACGLN
    Factor H cDNA ORF Clone, Rat, C-GFPSpark® tag RG81017-ACG
    Factor H cDNA ORF Clone, Rat, N-GFPSpark® tag RG81017-ANG
    Factor H cDNA ORF Clone, Rat, C-OFPSpark® tag RG81017-ACR
    Factor H cDNA ORF Clone, Rat, N-OFPSpark® tag RG81017-ANR
    Factor H cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81017-CF
    Factor H cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81017-NF
    Factor H cDNA ORF Clone, Rat, C-His tag RG81017-CH
    Factor H cDNA ORF Clone, Rat, N-His tag RG81017-NH
    Factor H cDNA ORF Clone, Rat, C-HA tag RG81017-CY
    Factor H cDNA ORF Clone, Rat, N-HA tag RG81017-NY
    Factor H cDNA ORF Clone, Rat, C-Myc tag RG81017-CM
    Factor H cDNA ORF Clone, Rat, N-Myc tag RG81017-NM
    Factor H qPCR Primer Pairs, Rat RP300981

    Factor H cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Factor H cDNA ORF Clone in Cloning Vector, Mouse MG51160-U
    Factor H cDNA ORF Clone, Mouse, untagged MG51160-UT
    Factor H Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51160-ACGLN
    Factor H cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51160-ACG
    Factor H cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51160-ACR
    Factor H cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51160-CF
    Factor H cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51160-NF
    Factor H cDNA ORF Clone, Mouse, C-His tag MG51160-CH
    Factor H cDNA ORF Clone, Mouse, N-His tag MG51160-NH
    Factor H cDNA ORF Clone, Mouse, C-HA tag MG51160-CY
    Factor H cDNA ORF Clone, Mouse, N-HA tag MG51160-NY
    Factor H cDNA ORF Clone, Mouse, C-Myc tag MG51160-CM
    Factor H cDNA ORF Clone, Mouse, N-Myc tag MG51160-NM

    Factor H cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Factor H cDNA ORF Clone in Cloning Vector, Human HG10714-G
    Factor H cDNA ORF Clone, Human, untagged HG10714-UT
    Factor H Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10714-ACGLN
    Factor H cDNA ORF Clone, Human, C-GFPSpark® tag HG10714-ACG
    Factor H cDNA ORF Clone, Human, C-OFPSpark® tag HG10714-ACR
    Factor H cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10714-CF
    Factor H cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10714-NF
    Factor H cDNA ORF Clone, Human, C-His tag HG10714-CH
    Factor H cDNA ORF Clone, Human, N-His tag HG10714-NH
    Factor H cDNA ORF Clone, Human, C-HA tag HG10714-CY
    Factor H cDNA ORF Clone, Human, N-HA tag HG10714-NY
    Factor H cDNA ORF Clone, Human, C-Myc tag HG10714-CM
    Factor H cDNA ORF Clone, Human, N-Myc tag HG10714-NM
    Factor H qPCR Primer Pairs, Human HP100887
    info info
    添加购物车成功! 添加购物车失败!