CD8 alpha cDNA ORF Clone, Rat, C-His tag

Cat: RG80285-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD8 alpha Reagents
CRO Services
Product recommended

All CD8 alpha Reagents
CD8 alpha cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Rat CD8a molecule with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD8 alpha Background Information

T-cell surface glycoprotein CD8 alpha chain, also known as CD8a, is a single-pass type I  membrane protein. The CD8 glycoprotein is expressed by thymocytes, mature T cells and natural killer (NK) cells and has been implicated in the recognition of monomorphic determinants on major histocompatibility complex (MHC) Class I antigens, and in signal transduction during the course of T-cell activation. Both human and rodent CD8 antigens are comprised of two distinct polypeptide chains, alpha and beta. The Ig domains of CD8 alpha are involved in controlling the ability of CD8 to be expressed. Mutation of B- and F-strand cysteine residues in CD8 alpha reduced the ability of the protein to fold properly and, therefore, to be expressed. Defects in CD8A are a cause of familial CD8 deficiency. Familial CD8 deficiency is a novel autosomal recessive immunologic defect characterized by absence of CD8+ cells, leading to recurrent bacterial infections.

Full Name
CD8a molecule
References
References Devine, L. et al., 2000, J Immunol. 164 (2): 833-8. Arcaro, A. et al., 2000, J Immunol. 165 (4): 2068-76. Saha, K. et al., 2001, Nat Med. 7 (1): 65-72. Romero, P. et al., 2005, Eur J Immunol. 35 (11): 3092-4.

CD8 alpha cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
CD8 alpha cDNA ORF Clone in Cloning Vector, Ferret FG60001-G
CD8 alpha cDNA ORF Clone, Ferret, untagged FG60001-UT
CD8 alpha cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60001-ACG
CD8 alpha Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60001-ACGLN
CD8 alpha cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60001-ACR
CD8 alpha cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60001-CF
CD8 alpha cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60001-NF
CD8 alpha cDNA ORF Clone, Ferret, C-His tag FG60001-CH
CD8 alpha cDNA ORF Clone, Ferret, N-His tag FG60001-NH
CD8 alpha cDNA ORF Clone, Ferret, C-HA tag FG60001-CY
CD8 alpha cDNA ORF Clone, Ferret, N-HA tag FG60001-NY
CD8 alpha cDNA ORF Clone, Ferret, C-Myc tag FG60001-CM
CD8 alpha cDNA ORF Clone, Ferret, N-Myc tag FG60001-NM

CD8 alpha cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
CD8 alpha cDNA ORF Clone, Cynomolgus, untagged CG90888-UT

CD8 alpha cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CD8 alpha cDNA ORF Clone in Cloning Vector, Rat RG80285-G
CD8 alpha cDNA ORF Clone, Rat, untagged RG80285-UT
CD8 alpha cDNA ORF Clone, Rat, C-GFPSpark® tag RG80285-ACG
CD8 alpha Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80285-ACGLN
CD8 alpha cDNA ORF Clone, Rat, C-OFPSpark® tag RG80285-ACR
CD8 alpha cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80285-CF
CD8 alpha cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80285-NF
CD8 alpha cDNA ORF Clone, Rat, N-His tag RG80285-NH
CD8 alpha cDNA ORF Clone, Rat, C-HA tag RG80285-CY
CD8 alpha cDNA ORF Clone, Rat, N-HA tag RG80285-NY
CD8 alpha cDNA ORF Clone, Rat, C-Myc tag RG80285-CM
CD8 alpha cDNA ORF Clone, Rat, N-Myc tag RG80285-NM
CD8 alpha qPCR Primer Pairs, Rat RP300390

CD8 alpha cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CD8 alpha cDNA ORF Clone in Cloning Vector, Mouse MG50389-M
CD8 alpha cDNA ORF Clone, Mouse, untagged MG50389-UT
CD8 alpha Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50389-ACGLN
CD8 alpha cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50389-ACG
CD8 alpha cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50389-ACR
CD8 alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50389-CF
CD8 alpha cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50389-NF
CD8 alpha cDNA ORF Clone, Mouse, C-His tag MG50389-CH
CD8 alpha cDNA ORF Clone, Mouse, N-His tag MG50389-NH
CD8 alpha cDNA ORF Clone, Mouse, C-HA tag MG50389-CY
CD8 alpha cDNA ORF Clone, Mouse, N-HA tag MG50389-NY
CD8 alpha cDNA ORF Clone, Mouse, C-Myc tag MG50389-CM
CD8 alpha cDNA ORF Clone, Mouse, N-Myc tag MG50389-NM
CD8 alpha qPCR Primer Pairs, Mouse MP200408

CD8 alpha cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD8 alpha cDNA ORF Clone in Cloning Vector, Human HG10980-M
CD8 alpha cDNA ORF Clone, Human, untagged HG10980-UT
CD8 alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10980-ACGLN
CD8 alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG10980-ACG
CD8 alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG10980-ACR
CD8 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10980-CF
CD8 alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10980-NF
CD8 alpha cDNA ORF Clone, Human, C-His tag HG10980-CH
CD8 alpha cDNA ORF Clone, Human, N-His tag HG10980-NH
CD8 alpha cDNA ORF Clone, Human, C-HA tag HG10980-CY
CD8 alpha cDNA ORF Clone, Human, N-HA tag HG10980-NY
CD8 alpha cDNA ORF Clone, Human, C-Myc tag HG10980-CM
CD8 alpha cDNA ORF Clone, Human, N-Myc tag HG10980-NM
CD8 alpha qPCR Primer Pairs, Human HP100945
info info
添加购物车成功! 添加购物车失败!