CD83 cDNA ORF Clone, Rat, N-His tag

Cat: RG80333-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD83 Reagents
CRO Services
Product recommended

All CD83 Reagents
CD83 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
592 bp
Description
Full length Clone DNA of Rat Cd83 molecule with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD83 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD83 is considered as a marker of mature dendritic cells as well as an adhesion receptor that binds to resting monocytes and a subset of activated CD8+ T cells. In certain conditions, CD83 tended to dimerize or even multimerize through its aberrant intermolecular disulfide bonds. The injection of CD83-Ig can significantly enhaunce the rate of tumor growth and inhibit the T cell growth.

Full Name
CD83 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Scholler N, et al.(2002) Cutting Edge: CD83 Regulates the Development of Cellular Immunity. The Journal of Immunology. 168 (6): 2599-602.
  • Lechmann M, et al.(2002) CD83 on dendritic cells: more than just a marker for maturation. Trends in immunology. 23(6): 273-5.
  • CD83 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD83 cDNA ORF Clone in Cloning Vector, Rhesus CG90199-G
    CD83 cDNA ORF Clone, Rhesus, untagged CG90199-UT
    CD83 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90199-ACG
    CD83 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90199-ACGLN
    CD83 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90199-ACR
    CD83 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90199-CF
    CD83 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90199-NF
    CD83 cDNA ORF Clone, Rhesus, C-His tag CG90199-CH
    CD83 cDNA ORF Clone, Rhesus, N-His tag CG90199-NH
    CD83 cDNA ORF Clone, Rhesus, C-HA tag CG90199-CY
    CD83 cDNA ORF Clone, Rhesus, N-HA tag CG90199-NY
    CD83 cDNA ORF Clone, Rhesus, C-Myc tag CG90199-CM
    CD83 cDNA ORF Clone, Rhesus, N-Myc tag CG90199-NM

    CD83 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD83 cDNA ORF Clone in Cloning Vector, Rat RG80333-G
    CD83 cDNA ORF Clone, Rat, untagged RG80333-UT
    CD83 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80333-ACG
    CD83 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80333-ACGLN
    CD83 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80333-ACR
    CD83 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80333-CF
    CD83 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80333-NF
    CD83 cDNA ORF Clone, Rat, C-His tag RG80333-CH
    CD83 cDNA ORF Clone, Rat, C-HA tag RG80333-CY
    CD83 cDNA ORF Clone, Rat, N-HA tag RG80333-NY
    CD83 cDNA ORF Clone, Rat, C-Myc tag RG80333-CM
    CD83 cDNA ORF Clone, Rat, N-Myc tag RG80333-NM
    CD83 qPCR Primer Pairs, Rat RP300303

    CD83 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD83 cDNA ORF Clone in Cloning Vector, Mouse MG50694-G
    CD83 cDNA ORF Clone, Mouse, untagged MG50694-UT
    CD83 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50694-ACGLN
    CD83 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50694-ACG
    CD83 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50694-ACR
    CD83 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50694-CF
    CD83 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50694-NF
    CD83 cDNA ORF Clone, Mouse, C-His tag MG50694-CH
    CD83 cDNA ORF Clone, Mouse, N-His tag MG50694-NH
    CD83 cDNA ORF Clone, Mouse, C-HA tag MG50694-CY
    CD83 cDNA ORF Clone, Mouse, N-HA tag MG50694-NY
    CD83 cDNA ORF Clone, Mouse, C-Myc tag MG50694-CM
    CD83 cDNA ORF Clone, Mouse, N-Myc tag MG50694-NM
    CD83 qPCR Primer Pairs, Mouse MP200670
    info info
    添加购物车成功! 添加购物车失败!