CD53 cDNA ORF Clone, Rat, C-His tag

Cat: RG80303-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD53 Reagents
CRO Services
Product recommended

All CD53 Reagents
CD53 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
660 bp
Description
Full length Clone DNA of Rat Cd53 molecule with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD53 Background Information

CD53 is a member of the transmembrane 4 superfamily, also called the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. These proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. CD53 is a cell surface glycoprotein that is known to complex with integrins. Familial deficiency of CD53 gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. CD53 contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation.

Full Name
CD53 molecule
References
  • Rochelle JM, et al. (1993) Gene structure, chromosomal localization, and protein sequence of mouse CD53 (Cd53): evidence that the transmembrane 4 superfamily arose by gene duplication. Int Immunol. 5(2):209-16.
  • Virtaneva KI, et al. (1993) The genes for CD37, CD53, and R2, all members of a novel gene family, are located on different chromosomes. Immunogenetics. 37(6):461-5.
  • Horejsí V, et al. (1991) Novel structurally distinct family of leucocyte surface glycoproteins including CD9, CD37, CD53 and CD63. FEBS Lett. 288(1-2):1-4.
  • CD53 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD53 cDNA ORF Clone in Cloning Vector, Rhesus CG90189-G
    CD53 cDNA ORF Clone, Rhesus, untagged CG90189-UT
    CD53 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90189-ACG
    CD53 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90189-ACGLN
    CD53 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90189-ACR
    CD53 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90189-CF
    CD53 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90189-NF
    CD53 cDNA ORF Clone, Rhesus, C-His tag CG90189-CH
    CD53 cDNA ORF Clone, Rhesus, N-His tag CG90189-NH
    CD53 cDNA ORF Clone, Rhesus, C-HA tag CG90189-CY
    CD53 cDNA ORF Clone, Rhesus, N-HA tag CG90189-NY
    CD53 cDNA ORF Clone, Rhesus, C-Myc tag CG90189-CM
    CD53 cDNA ORF Clone, Rhesus, N-Myc tag CG90189-NM

    CD53 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD53 cDNA ORF Clone in Cloning Vector, Rat RG80303-G
    CD53 cDNA ORF Clone, Rat, untagged RG80303-UT
    CD53 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80303-ACGLN
    CD53 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80303-ACG
    CD53 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80303-ACR
    CD53 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80303-CF
    CD53 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80303-NF
    CD53 cDNA ORF Clone, Rat, N-His tag RG80303-NH
    CD53 cDNA ORF Clone, Rat, C-HA tag RG80303-CY
    CD53 cDNA ORF Clone, Rat, N-HA tag RG80303-NY
    CD53 cDNA ORF Clone, Rat, C-Myc tag RG80303-CM
    CD53 cDNA ORF Clone, Rat, N-Myc tag RG80303-NM
    CD53 qPCR Primer Pairs, Rat RP300279

    CD53 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD53 cDNA ORF Clone in Cloning Vector, Mouse MG50722-G
    CD53 cDNA ORF Clone, Mouse, untagged MG50722-UT
    CD53 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50722-ACG
    CD53 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50722-ACGLN
    CD53 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50722-ACR
    CD53 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50722-CF
    CD53 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50722-NF
    CD53 cDNA ORF Clone, Mouse, C-His tag MG50722-CH
    CD53 cDNA ORF Clone, Mouse, N-His tag MG50722-NH
    CD53 cDNA ORF Clone, Mouse, C-HA tag MG50722-CY
    CD53 cDNA ORF Clone, Mouse, N-HA tag MG50722-NY
    CD53 cDNA ORF Clone, Mouse, C-Myc tag MG50722-CM
    CD53 cDNA ORF Clone, Mouse, N-Myc tag MG50722-NM
    CD53 qPCR Primer Pairs, Mouse MP200697

    CD53 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD53 cDNA ORF Clone in Cloning Vector, Human HG11409-M
    CD53 cDNA ORF Clone, Human, untagged HG11409-UT
    CD53 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11409-ACGLN
    CD53 cDNA ORF Clone, Human, C-GFPSpark® tag HG11409-ACG
    CD53 cDNA ORF Clone, Human, C-OFPSpark® tag HG11409-ACR
    CD53 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11409-CF
    CD53 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11409-NF
    CD53 cDNA ORF Clone, Human, C-His tag HG11409-CH
    CD53 cDNA ORF Clone, Human, N-His tag HG11409-NH
    CD53 cDNA ORF Clone, Human, C-HA tag HG11409-CY
    CD53 cDNA ORF Clone, Human, N-HA tag HG11409-NY
    CD53 cDNA ORF Clone, Human, C-Myc tag HG11409-CM
    CD53 cDNA ORF Clone, Human, N-Myc tag HG11409-NM
    CD53 qPCR Primer Pairs, Human HP101287
    info info
    添加购物车成功! 添加购物车失败!