ATG4B cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81097-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ATG4B Reagents
CRO Services
Product recommended

All ATG4B Reagents
ATG4B cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Rat autophagy related 4B, cysteine peptidase with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATG4B Background Information
Full Name
autophagy related 4B, cysteine peptidase

ATG4B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATG4B cDNA ORF Clone in Cloning Vector, Rat RG81097-U
ATG4B cDNA ORF Clone, Rat, untagged RG81097-UT
ATG4B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81097-ACGLN
ATG4B cDNA ORF Clone, Rat, C-GFPSpark® tag RG81097-ACG
ATG4B cDNA ORF Clone, Rat, N-GFPSpark® tag RG81097-ANG
ATG4B cDNA ORF Clone, Rat, C-OFPSpark® tag RG81097-ACR
ATG4B cDNA ORF Clone, Rat, N-OFPSpark® tag RG81097-ANR
ATG4B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81097-CF
ATG4B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81097-NF
ATG4B cDNA ORF Clone, Rat, C-His tag RG81097-CH
ATG4B cDNA ORF Clone, Rat, N-His tag RG81097-NH
ATG4B cDNA ORF Clone, Rat, C-HA tag RG81097-CY
ATG4B cDNA ORF Clone, Rat, N-HA tag RG81097-NY
ATG4B cDNA ORF Clone, Rat, N-Myc tag RG81097-NM
ATG4B qPCR Primer Pairs, Rat RP301054

ATG4B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATG4B cDNA ORF Clone in Cloning Vector, Mouse MG53831-U
ATG4B cDNA ORF Clone, Mouse, untagged MG53831-UT
ATG4B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53831-ACG
ATG4B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53831-ACGLN
ATG4B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53831-ANG
ATG4B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53831-ACR
ATG4B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53831-ANR
ATG4B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53831-CF
ATG4B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53831-NF
ATG4B cDNA ORF Clone, Mouse, C-His tag MG53831-CH
ATG4B cDNA ORF Clone, Mouse, N-His tag MG53831-NH
ATG4B cDNA ORF Clone, Mouse, C-HA tag MG53831-CY
ATG4B cDNA ORF Clone, Mouse, N-HA tag MG53831-NY
ATG4B cDNA ORF Clone, Mouse, C-Myc tag MG53831-CM
ATG4B cDNA ORF Clone, Mouse, N-Myc tag MG53831-NM

ATG4B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATG4B cDNA ORF Clone in Cloning Vector, Human HG20407-G
ATG4B cDNA ORF Clone, Human, untagged HG20407-UT
ATG4B cDNA ORF Clone, Human, C-GFPSpark® tag HG20407-ACG
ATG4B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20407-ACGLN
ATG4B cDNA ORF Clone, Human, N-GFPSpark® tag HG20407-ANG
ATG4B cDNA ORF Clone, Human, C-OFPSpark® tag HG20407-ACR
ATG4B cDNA ORF Clone, Human, N-OFPSpark® tag HG20407-ANR
ATG4B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20407-CF
ATG4B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20407-NF
ATG4B cDNA ORF Clone, Human, C-His tag HG20407-CH
ATG4B cDNA ORF Clone, Human, N-His tag HG20407-NH
ATG4B cDNA ORF Clone, Human, C-HA tag HG20407-CY
ATG4B cDNA ORF Clone, Human, N-HA tag HG20407-NY
ATG4B cDNA ORF Clone, Human, C-Myc tag HG20407-CM
ATG4B cDNA ORF Clone, Human, N-Myc tag HG20407-NM
info info
添加购物车成功! 添加购物车失败!