ANGPTL2 cDNA ORF Clone, Rat, untagged

Cat: RG81033-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ANGPTL2 Reagents
CRO Services
Product recommended

All ANGPTL2 Reagents
ANGPTL2 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1482 bp
Description
Full length Clone DNA of Rat angiopoietin-like 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANGPTL2 Background Information
Full Name
angiopoietin-like 2

ANGPTL2 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
ANGPTL2 cDNA ORF Clone in Cloning Vector, Canine DG70033-G
ANGPTL2 cDNA ORF Clone, Canine, untagged DG70033-UT
ANGPTL2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70033-ACG
ANGPTL2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70033-ACGLN
ANGPTL2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70033-ACR
ANGPTL2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70033-CF
ANGPTL2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70033-NF
ANGPTL2 cDNA ORF Clone, Canine, C-His tag DG70033-CH
ANGPTL2 cDNA ORF Clone, Canine, N-His tag DG70033-NH
ANGPTL2 cDNA ORF Clone, Canine, C-HA tag DG70033-CY
ANGPTL2 cDNA ORF Clone, Canine, N-HA tag DG70033-NY
ANGPTL2 cDNA ORF Clone, Canine, C-Myc tag DG70033-CM
ANGPTL2 cDNA ORF Clone, Canine, N-Myc tag DG70033-NM

ANGPTL2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ANGPTL2 cDNA ORF Clone in Cloning Vector, Rat RG81033-U
ANGPTL2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81033-ACG
ANGPTL2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81033-ACGLN
ANGPTL2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81033-ACR
ANGPTL2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81033-CF
ANGPTL2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81033-NF
ANGPTL2 cDNA ORF Clone, Rat, C-His tag RG81033-CH
ANGPTL2 cDNA ORF Clone, Rat, N-His tag RG81033-NH
ANGPTL2 cDNA ORF Clone, Rat, C-HA tag RG81033-CY
ANGPTL2 cDNA ORF Clone, Rat, N-HA tag RG81033-NY
ANGPTL2 cDNA ORF Clone, Rat, C-Myc tag RG81033-CM
ANGPTL2 cDNA ORF Clone, Rat, N-Myc tag RG81033-NM
ANGPTL2 qPCR Primer Pairs, Rat RP300997

ANGPTL2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ANGPTL2 cDNA ORF Clone in Cloning Vector, Mouse MG50301-M
ANGPTL2 cDNA ORF Clone, Mouse, untagged MG50301-UT
ANGPTL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50301-ACG
ANGPTL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50301-ACGLN
ANGPTL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50301-ACR
ANGPTL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50301-CF
ANGPTL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50301-NF
ANGPTL2 cDNA ORF Clone, Mouse, C-His tag MG50301-CH
ANGPTL2 cDNA ORF Clone, Mouse, N-His tag MG50301-NH
ANGPTL2 cDNA ORF Clone, Mouse, C-HA tag MG50301-CY
ANGPTL2 cDNA ORF Clone, Mouse, N-HA tag MG50301-NY
ANGPTL2 cDNA ORF Clone, Mouse, C-Myc tag MG50301-CM
ANGPTL2 cDNA ORF Clone, Mouse, N-Myc tag MG50301-NM
ANGPTL2 qPCR Primer Pairs, Mouse MP200324

ANGPTL2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANGPTL2 cDNA ORF Clone in Cloning Vector, Human HG11014-M
ANGPTL2 cDNA ORF Clone, Human, untagged HG11014-UT
ANGPTL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11014-ACG
ANGPTL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11014-ACGLN
ANGPTL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11014-ACR
ANGPTL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11014-CF
ANGPTL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11014-NF
ANGPTL2 cDNA ORF Clone, Human, C-His tag HG11014-CH
ANGPTL2 cDNA ORF Clone, Human, N-His tag HG11014-NH
ANGPTL2 cDNA ORF Clone, Human, C-HA tag HG11014-CY
ANGPTL2 cDNA ORF Clone, Human, N-HA tag HG11014-NY
ANGPTL2 cDNA ORF Clone, Human, C-Myc tag HG11014-CM
ANGPTL2 cDNA ORF Clone, Human, N-Myc tag HG11014-NM
ANGPTL2 qPCR Primer Pairs, Human HP100975
info info
添加购物车成功! 添加购物车失败!