Neurolysin cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10255-M-F

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Neurolysin Reagents
CRO Services

All Neurolysin Reagents
Neurolysin cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2115 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 1977 A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human neurolysin (metallopeptidase M3 family) with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 2.17kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Neurolysin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Neurolysin cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
AGTBP cDNA ORF Clone, Human;EP24.16 cDNA ORF Clone, Human;KIAA1226 cDNA ORF Clone, Human;MEP cDNA ORF Clone, Human;MOP cDNA ORF Clone, Human;NLN cDNA ORF Clone, Human
Neurolysin Background Information
Full Name
neurolysin (metallopeptidase M3 family)
Research Areas

Neurolysin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Neurolysin cDNA ORF Clone in Cloning Vector, Mouse MG50333-M
Neurolysin cDNA ORF Clone, Mouse, untagged MG50333-UT
Neurolysin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50333-ACG
Neurolysin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50333-ACGLN
Neurolysin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50333-ANG
Neurolysin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50333-ACR
Neurolysin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50333-ANR
Neurolysin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50333-CF
Neurolysin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50333-NF
Neurolysin cDNA ORF Clone, Mouse, C-His tag MG50333-CH
Neurolysin cDNA ORF Clone, Mouse, N-His tag MG50333-NH
Neurolysin cDNA ORF Clone, Mouse, C-HA tag MG50333-CY
Neurolysin cDNA ORF Clone, Mouse, N-HA tag MG50333-NY
Neurolysin cDNA ORF Clone, Mouse, C-Myc tag MG50333-CM
Neurolysin cDNA ORF Clone, Mouse, N-Myc tag MG50333-NM
Neurolysin qPCR Primer Pairs, Mouse MP200356

Neurolysin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Neurolysin cDNA ORF Clone in Cloning Vector, Human HG10255-M
Neurolysin cDNA ORF Clone, Human, untagged HG10255-UT
Neurolysin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10255-ACGLN
Neurolysin cDNA ORF Clone, Human, C-GFPSpark® tag HG10255-ACG
Neurolysin cDNA ORF Clone, Human, N-GFPSpark® tag HG10255-ANG
Neurolysin cDNA ORF Clone, Human, C-OFPSpark® tag HG10255-ACR
Neurolysin cDNA ORF Clone, Human, N-OFPSpark® tag HG10255-ANR
Neurolysin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10255-CF
Neurolysin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10255-NF
Neurolysin cDNA ORF Clone, Human, C-His tag HG10255-CH
Neurolysin cDNA ORF Clone, Human, N-His tag HG10255-NH
Neurolysin cDNA ORF Clone, Human, C-HA tag HG10255-CY
Neurolysin cDNA ORF Clone, Human, N-HA tag HG10255-NY
Neurolysin cDNA ORF Clone, Human, C-Myc tag HG10255-CM
Neurolysin cDNA ORF Clone, Human, N-Myc tag HG10255-NM
Neurolysin qPCR Primer Pairs, Human HP100304
info info
添加购物车成功! 添加购物车失败!