ZBTB16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51029-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ZBTB16 Reagents
CRO Services
Product recommended

All ZBTB16 Reagents
ZBTB16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2061 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 216 A/G, 606 C/T, 861 T/C, 1062 C/T, 1221 C/T, 1731 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Mouse zinc finger and BTB domain containing 16 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Flag
Restriction Sites
KpnI+XbaI(6kb+2.06kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ZBTB16 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ZBTB16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Mouse ZBTB16 Gene Expression validated Image 14352
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
ZBTB16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
AI467657 cDNA ORF Clone, Mouse;lu cDNA ORF Clone, Mouse;PLZF cDNA ORF Clone, Mouse;Zfp145 cDNA ORF Clone, Mouse
ZBTB16 Background Information
Full Name
zinc finger and BTB domain containing 16

ZBTB16 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ZBTB16 cDNA ORF Clone in Cloning Vector, Mouse MG51029-G
ZBTB16 cDNA ORF Clone, Mouse, untagged MG51029-UT
ZBTB16 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51029-ACG
ZBTB16 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51029-ACGLN
ZBTB16 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51029-ANG
ZBTB16 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51029-ACR
ZBTB16 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51029-ANR
ZBTB16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51029-NF
ZBTB16 cDNA ORF Clone, Mouse, C-His tag MG51029-CH
ZBTB16 cDNA ORF Clone, Mouse, N-His tag MG51029-NH
ZBTB16 cDNA ORF Clone, Mouse, C-HA tag MG51029-CY
ZBTB16 cDNA ORF Clone, Mouse, N-HA tag MG51029-NY
ZBTB16 cDNA ORF Clone, Mouse, C-Myc tag MG51029-CM
ZBTB16 cDNA ORF Clone, Mouse, N-Myc tag MG51029-NM
ZBTB16 qPCR Primer Pairs, Mouse MP200988

ZBTB16 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ZBTB16 cDNA ORF Clone in Cloning Vector, Human HG10802-M
ZBTB16 cDNA ORF Clone, Human, untagged HG10802-UT
ZBTB16 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10802-ACGLN
ZBTB16 cDNA ORF Clone, Human, C-GFPSpark® tag HG10802-ACG
ZBTB16 cDNA ORF Clone, Human, N-GFPSpark® tag HG10802-ANG
ZBTB16 cDNA ORF Clone, Human, C-OFPSpark® tag HG10802-ACR
ZBTB16 cDNA ORF Clone, Human, N-OFPSpark® tag HG10802-ANR
ZBTB16 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10802-CF
ZBTB16 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10802-NF
ZBTB16 cDNA ORF Clone, Human, C-His tag HG10802-CH
ZBTB16 cDNA ORF Clone, Human, N-His tag HG10802-NH
ZBTB16 cDNA ORF Clone, Human, C-HA tag HG10802-CY
ZBTB16 cDNA ORF Clone, Human, N-HA tag HG10802-NY
ZBTB16 cDNA ORF Clone, Human, C-Myc tag HG10802-CM
ZBTB16 cDNA ORF Clone, Human, N-Myc tag HG10802-NM
ZBTB16 qPCR Primer Pairs, Human HP100716
info info
添加购物车成功! 添加购物车失败!