TUBG2 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52009-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TUBG2 Reagents

CRO Services

Product recommended


All TUBG2 Reagents

TUBG2 cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1356 bp
Description
Full length Clone DNA of Mouse tubulin, gamma 2 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TUBG2 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names

AI504772 cDNA ORF Clone, Mouse;Tubgl cDNA ORF Clone, Mouse

TUBG2 Background Information

Full Name
tubulin, gamma 2

TUBG2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TUBG2 cDNA ORF Clone in Cloning Vector, Mouse MG52009-G
TUBG2 cDNA ORF Clone, Mouse, untagged MG52009-UT
TUBG2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52009-ACG
TUBG2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52009-ACGLN
TUBG2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52009-ANG
TUBG2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52009-ACR
TUBG2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52009-ANR
TUBG2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52009-CF
TUBG2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52009-NF
TUBG2 cDNA ORF Clone, Mouse, C-His tag MG52009-CH
TUBG2 cDNA ORF Clone, Mouse, N-His tag MG52009-NH
TUBG2 cDNA ORF Clone, Mouse, C-HA tag MG52009-CY
TUBG2 cDNA ORF Clone, Mouse, N-HA tag MG52009-NY
TUBG2 cDNA ORF Clone, Mouse, C-Myc tag MG52009-CM
TUBG2 qPCR Primer Pairs, Mouse MP201882

TUBG2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TUBG2 cDNA ORF Clone in Cloning Vector, Human HG14069-G
TUBG2 cDNA ORF Clone, Human, untagged HG14069-UT
TUBG2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14069-ACGLN
TUBG2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14069-ACG
TUBG2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14069-ANG
TUBG2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14069-ACR
TUBG2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14069-ANR
TUBG2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14069-CF
TUBG2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14069-NF
TUBG2 cDNA ORF Clone, Human, C-His tag HG14069-CH
TUBG2 cDNA ORF Clone, Human, N-His tag HG14069-NH
TUBG2 cDNA ORF Clone, Human, C-HA tag HG14069-CY
TUBG2 cDNA ORF Clone, Human, N-HA tag HG14069-NY
TUBG2 cDNA ORF Clone, Human, C-Myc tag HG14069-CM
TUBG2 cDNA ORF Clone, Human, N-Myc tag HG14069-NM
TUBG2 qPCR Primer Pairs, Human HP102724
info info
添加购物车成功! 添加购物车失败!