TTLL12 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52814-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TTLL12 Reagents
CRO Services
Product recommended

All TTLL12 Reagents
TTLL12 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1920 bp
Description
Full length Clone DNA of Mouse tubulin tyrosine ligase-like family, member 12 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TTLL12 cDNA ORF Clone, Mouse, N-His tag Alternative Names
BC055368 cDNA ORF Clone, Mouse;D430005B17 cDNA ORF Clone, Mouse
TTLL12 Background Information
Full Name
tubulin tyrosine ligase-like family member 12

TTLL12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TTLL12 cDNA ORF Clone in Cloning Vector, Mouse MG52814-G
TTLL12 cDNA ORF Clone, Mouse, untagged MG52814-UT
TTLL12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52814-ACGLN
TTLL12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52814-ACG
TTLL12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52814-ANG
TTLL12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52814-ACR
TTLL12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52814-ANR
TTLL12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52814-CF
TTLL12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52814-NF
TTLL12 cDNA ORF Clone, Mouse, C-His tag MG52814-CH
TTLL12 cDNA ORF Clone, Mouse, C-HA tag MG52814-CY
TTLL12 cDNA ORF Clone, Mouse, N-HA tag MG52814-NY
TTLL12 cDNA ORF Clone, Mouse, C-Myc tag MG52814-CM
TTLL12 cDNA ORF Clone, Mouse, N-Myc tag MG52814-NM

TTLL12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TTLL12 cDNA ORF Clone in Cloning Vector, Human HG22532-U
TTLL12 cDNA ORF Clone, Human, untagged HG22532-UT
TTLL12 cDNA ORF Clone, Human, C-GFPSpark® tag HG22532-ACG
TTLL12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22532-ACGLN
TTLL12 cDNA ORF Clone, Human, N-GFPSpark® tag HG22532-ANG
TTLL12 cDNA ORF Clone, Human, C-OFPSpark® tag HG22532-ACR
TTLL12 cDNA ORF Clone, Human, N-OFPSpark® tag HG22532-ANR
TTLL12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22532-CF
TTLL12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22532-NF
TTLL12 cDNA ORF Clone, Human, C-His tag HG22532-CH
TTLL12 cDNA ORF Clone, Human, N-His tag HG22532-NH
TTLL12 cDNA ORF Clone, Human, C-HA tag HG22532-CY
TTLL12 cDNA ORF Clone, Human, N-HA tag HG22532-NY
TTLL12 cDNA ORF Clone, Human, C-Myc tag HG22532-CM
TTLL12 cDNA ORF Clone, Human, N-Myc tag HG22532-NM
info info
添加购物车成功! 添加购物车失败!