TSSC4 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51654-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TSSC4 Reagents
CRO Services
Product recommended

All TSSC4 Reagents
TSSC4 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
954 bp
Description
Full length Clone DNA of Mouse tumor-suppressing subchromosomal transferable fragment 4 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TSSC4 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AA241958 cDNA ORF Clone, Mouse;ESTM671070 cDNA ORF Clone, Mouse
TSSC4 Background Information
Full Name
tumor suppressing subtransferable candidate 4

TSSC4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TSSC4 cDNA ORF Clone in Cloning Vector, Mouse MG51654-U
TSSC4 cDNA ORF Clone, Mouse, untagged MG51654-UT
TSSC4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51654-ACG
TSSC4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51654-ACGLN
TSSC4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51654-ANG
TSSC4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51654-ACR
TSSC4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51654-ANR
TSSC4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51654-CF
TSSC4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51654-NF
TSSC4 cDNA ORF Clone, Mouse, C-His tag MG51654-CH
TSSC4 cDNA ORF Clone, Mouse, N-His tag MG51654-NH
TSSC4 cDNA ORF Clone, Mouse, C-HA tag MG51654-CY
TSSC4 cDNA ORF Clone, Mouse, N-HA tag MG51654-NY
TSSC4 cDNA ORF Clone, Mouse, N-Myc tag MG51654-NM
TSSC4 qPCR Primer Pairs, Mouse MP201527

TSSC4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TSSC4 cDNA ORF Clone in Cloning Vector, Human HG17166-U
TSSC4 cDNA ORF Clone, Human, untagged HG17166-UT
TSSC4 cDNA ORF Clone, Human, C-GFPSpark® tag HG17166-ACG
TSSC4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17166-ACGLN
TSSC4 cDNA ORF Clone, Human, N-GFPSpark® tag HG17166-ANG
TSSC4 cDNA ORF Clone, Human, C-OFPSpark® tag HG17166-ACR
TSSC4 cDNA ORF Clone, Human, N-OFPSpark® tag HG17166-ANR
TSSC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17166-CF
TSSC4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17166-NF
TSSC4 cDNA ORF Clone, Human, C-His tag HG17166-CH
TSSC4 cDNA ORF Clone, Human, N-His tag HG17166-NH
TSSC4 cDNA ORF Clone, Human, C-HA tag HG17166-CY
TSSC4 cDNA ORF Clone, Human, N-HA tag HG17166-NY
TSSC4 cDNA ORF Clone, Human, C-Myc tag HG17166-CM
TSSC4 cDNA ORF Clone, Human, N-Myc tag HG17166-NM
info info
添加购物车成功! 添加购物车失败!